BMRBj - BMREntryMaster

Found 1 Document (0.335 seconds)

BMRB: 30533

6MXQ

Solution structure of a c-JUN 5' UTR stem-loop associated with specialized cap-dependent translation initiation

Authors

Walker, M., Shortridge, M., Varani, G.

Assembly

C-JUN TL

Entity

1. C-JUN TL (polymer, Thiol state: not present), 49 monomers, 15586.15 Da Detail

GGCAGUAUAG UCCGAACUGC AACUUCGGUU CACCUUCUCU CUAACUGCC

Formula weight

15586.15 Da

Source organism

Homo sapiens

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 87.5 %, Completeness (bb): 87.2 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	87.5 % (696 of 795)	79.9 % (350 of 438)	99.4 % (332 of 334)	60.9 % (14 of 23)
Suger, PO4	87.2 % (470 of 539)	76.9 % (226 of 294)	99.6 % (244 of 245)
Nucleobase	88.3 % (226 of 256)	86.1 % (124 of 144)	98.9 % (88 of 89)	60.9 % (14 of 23)
Aromatic	92.4 % (207 of 224)	93.8 % (105 of 112)	98.9 % (88 of 89)	60.9 % (14 of 23)

1. entity 1

GGCAGUAUAG UCCGAACUGC AACUUCGGUU CACCUUCUCU CUAACUGCC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
1	RNA	natural abundance		1.0 mM
2	Sodium Phosphate	natural abundance		20 mM

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM RNA, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
3	RNA	natural abundance		1.0 mM
4	Sodium Phosphate	natural abundance		20 mM

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM [A,G-98% D3',4',5',5"; C,U-98%: D3',4',5, 5',5"] RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
5	RNA	[A,G-98% D3',4',5',5"; C,U-98%: D3',4',5, 5',5"]		1.0 mM
6	Sodium Phosphate	natural abundance		20 mM

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM [A,C,G,U-98% 13C, A,C,G,U-98% 15N] RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
7	RNA	[A,C,G,U-98% 13C, A,C,G,U-98% 15N]		1.0 mM
8	Sodium Phosphate	natural abundance		20 mM

Sample #5

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM [A,C,G,U-98% 13C, A,C,G,U-98% 15N] RNA, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
9	RNA	[A,C,G,U-98% 13C, A,C,G,U-98% 15N]		1.0 mM
10	Sodium Phosphate	natural abundance		20 mM

Release date

2018-11-13

Citation

Structure of the RNA Specialized Translation Initiation Element that Recruits eIF3 to the 5'-UTR of c-Jun
Walker, M., Shortridge, M., Albin, D., Cominsky, L., Varani, G.
J. Mol. Biol. (2020), 432, 1841-1855, PubMed 31953146 , DOI 10.1016/j.jmb.2020.01.001 , Abstract

Related entities 1. C-JUN TL, : 1 : 1 entities Detail

Experiments performed 7 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
1	RNA	natural abundance		1.0 mM
2	Sodium Phosphate	natural abundance		20 mM

2 2D 1H-1H NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.1, Details 1.0 mM RNA, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
3	RNA	natural abundance		1.0 mM
4	Sodium Phosphate	natural abundance		20 mM

3 2D 1H-1H NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM [A,G-98% D3',4',5',5"; C,U-98%: D3',4',5, 5',5"] RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
5	RNA	[A,G-98% D3',4',5',5"; C,U-98%: D3',4',5, 5',5"]		1.0 mM
6	Sodium Phosphate	natural abundance		20 mM

4 3D 1H-13C NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM [A,C,G,U-98% 13C, A,C,G,U-98% 15N] RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
7	RNA	[A,C,G,U-98% 13C, A,C,G,U-98% 15N]		1.0 mM
8	Sodium Phosphate	natural abundance		20 mM

5 2D 1H-15N HSQC

Instrument

Bruker AvanceII - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.1, Details 1.0 mM [A,C,G,U-98% 13C, A,C,G,U-98% 15N] RNA, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
9	RNA	[A,C,G,U-98% 13C, A,C,G,U-98% 15N]		1.0 mM
10	Sodium Phosphate	natural abundance		20 mM

6 2D 1H-13C HSQC

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM [A,C,G,U-98% 13C, A,C,G,U-98% 15N] RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
7	RNA	[A,C,G,U-98% 13C, A,C,G,U-98% 15N]		1.0 mM
8	Sodium Phosphate	natural abundance		20 mM

7 2D 1H-1H TOCSY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
1	RNA	natural abundance		1.0 mM
2	Sodium Phosphate	natural abundance		20 mM

Chemical shift validation 3 contents Detail

Properties

Input source #1: Assigned chemical shifts - Assigned chemical shifts	bmr30533_3.str
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Content subtype: bmr30533_3.str

#	Content subtype	Saveframe	Status	# of rows	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	765		100.0 (chain: 1, length: 49)
1	Chemical shift references	chem_shift_reference_1	OK	3		No information

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: 1, Chain length: 49, Sequence coverage: 100.0%

--------10--------20--------30--------40---------
GGCAGUAUAGUCCGAACUGCAACUUCGGUUCACCUUCUCUCUAACUGCC
|||||||||||||||||||||||||||||||||||||||||||||||||
GGCAGUAUAGUCCGAACUGCAACUUCGGUUCACCUUCUCUCUAACUGCC

Total number of assignments
- ¹H chemical shifts: 419
- ¹³C chemical shifts: 332
- ¹⁵N chemical shifts: 14

Completeness of assignments

Entity_assemble_ID: 1

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	HO2'	4.897
2	G	H21	6.753
2	G	H22	5.43
2	G	HO2'	4.509
3	C	HO2'	4.535
4	A	H61	7.466
4	A	H62	6.046
4	A	HO2'	4.585
5	G	H21	7.975
5	G	H22	5.732
5	G	HO2'	4.372
6	U	HO2'	4.242
7	A	HO2'	4.646
8	U	HO2'	4.418
9	A	H61	7.397
9	A	H62	6.091
9	A	HO2'	4.613
10	G	H21	8.529
10	G	H22	5.923
10	G	HO2'	4.423
11	U	HO2'	4.305
12	C	HO2'	3.999
13	C	HO2'	4.146
14	G	H21	5.856
14	G	HO2'	4.648
15	A	H61	7.692
15	A	H62	6.224
15	A	HO2'	4.749
16	A	H62	6.546
16	A	HO2'	4.546
17	C	HO2'	4.054
18	U	HO2'	4.153
19	G	HO2'	4.775
20	C	HO2'	4.41
21	A	HO2'	4.526
22	A	H61	8.034
22	A	H62	6.268
22	A	HO2'	4.536
23	C	HO2'	4.322
24	U	HO2'	3.732
25	U	HO2'	4.616
26	C	HO2'	4.041
27	G	HO2'	4.775
28	G	H21	8.543
28	G	H22	5.355
28	G	HO2'	4.383
29	U	HO2'	4.534
30	U	HO2'	4.453
31	C	HO2'	4.271
32	A	HO2'	4.391
33	C	HO2'	4.122
34	C	HO2'	4.32
35	U	HO2'	4.457
36	U	HO2'	4.479
37	C	HO2'	4.366
38	U	HO2'	4.104
39	C	HO2'	4.174
40	U	HO2'	4.302
41	C	HO2'	4.388
42	U	HO2'	4.57
43	A	HO2'	4.506
44	A	HO2'	4.458
45	C	HO2'	4.083
46	U	HO2'	4.531
47	G	H21	7.88
47	G	H22	5.636
47	G	HO2'	4.432
48	C	HO2'	4.167
49	C	HO2'	3.947

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	438	350	79.9
¹³C chemical shifts	334	332	99.4
¹⁵N chemical shifts	23	14	60.9

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	294	226	76.9
¹³C chemical shifts	245	244	99.6

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	144	124	86.1
¹³C chemical shifts	89	88	98.9
¹⁵N chemical shifts	23	14	60.9

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	29	29	100.0
¹³C chemical shifts	29	28	96.6

Histogram of normalized assigned chemical shifts

Keywords RNA, c-JUN, cap-dependent, eIF3, mRNA, specialized translation initiation

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.335 seconds)

BMRB: 30533

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Related entities 1. C-JUN TL, : 1 : 1 entities Detail

Experiments performed 7 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Chemical shift validation 3 contents Detail