BMRBj - BMREntryMaster

Found 1 Document (0.36 seconds)

BMRB: 30560

6NOA

Solution structure of a c-JUN 5' UTR stem-loop associated with specialized cap-dependent translation initiation (WT apical loop)

Authors

Walker, M., Shortridge, M., Varani, G.

Assembly

C-JUN TL

Entity

1. C-JUN TL (polymer, Thiol state: not present), 56 monomers, 17697.31 Da Detail

GGCAGUAUAG UCCGAACUGC AAAUCUUAUU UUCUUUUCAC CUUCUCUCUA ACUGCC

Formula weight

17697.31 Da

Source organism

Homo sapiens

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 75.6 %, Completeness (bb): 77.8 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	75.6 % (691 of 914)	77.4 % (388 of 501)	75.6 % (291 of 385)	42.9 % (12 of 28)
Suger, PO4	77.8 % (479 of 616)	78.9 % (265 of 336)	76.4 % (214 of 280)
Nucleobase	71.1 % (212 of 298)	74.5 % (123 of 165)	73.3 % (77 of 105)	42.9 % (12 of 28)
Aromatic	74.1 % (197 of 266)	81.2 % (108 of 133)	73.3 % (77 of 105)	42.9 % (12 of 28)

1. entity 1

GGCAGUAUAG UCCGAACUGC AAAUCUUAUU UUCUUUUCAC CUUCUCUCUA ACUGCC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM [A,G-98% D3', 4', 5', 5"; C,U-98% D3', 4', 5', 5", 5] RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
1	RNA	[A,G-98% D3', 4', 5', 5"; C,U-98% D3', 4', 5', 5", 5]		1.0 mM
2	Sodium Phosphate	natural abundance		20 mM

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
3	RNA	natural abundance		1.0 mM
4	Sodium Phosphate	natural abundance		20 mM

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM RNA, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
5	RNA	natural abundance		1.0 mM
6	Sodium Phosphate	natural abundance		20 mM

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
7	RNA	natural abundance		1.0 mM
8	Sodium Phosphate	natural abundance		20 mM

Sample #5

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM RNA, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
9	RNA	natural abundance		1.0 mM
10	Sodium Phosphate	natural abundance		20 mM

Sample #6

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM [A,G-98% D3', 4', 5', 5"; C,U-98% D3', 4', 5', 5", 5] RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
11	RNA	[A,G-98% D3', 4', 5', 5"; C,U-98% D3', 4', 5', 5", 5]		1.0 mM
12	Sodium Phosphate	natural abundance		20 mM

Sample #7

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM [A,C,G,U-98% 13C, A,C,G,U-98% 15N] RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
13	RNA	[A,C,G,U-98% 13C, A,C,G,U-98% 15N]		1.0 mM
14	Sodium Phosphate	natural abundance		20 mM

Sample #8

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM [A,C,G,U-98% 13C, A,C,G,U-98% 15N] RNA, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
15	RNA	[A,C,G,U-98% 13C, A,C,G,U-98% 15N]		1.0 mM
16	Sodium Phosphate	natural abundance		20 mM

Release date

2019-01-28

Citation

Structure of the RNA Specialized Translation Initiation Element that Recruits eIF3 to the 5'-UTR of c-Jun
Walker, M., Shortridge, M., Albin, D., Cominsky, L., Varani, G.
J. Mol. Biol. (2020), 432, 1841-1855, PubMed 31953146 , DOI 10.1016/j.jmb.2020.01.001 , Abstract

Related entities 1. C-JUN TL, : 1 : 1 entities Detail

Experiments performed 11 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM [A,G-98% D3', 4', 5', 5"; C,U-98% D3', 4', 5', 5", 5] RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
1	RNA	[A,G-98% D3', 4', 5', 5"; C,U-98% D3', 4', 5', 5", 5]		1.0 mM
2	Sodium Phosphate	natural abundance		20 mM

2 2D 1H-1H NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
3	RNA	natural abundance		1.0 mM
4	Sodium Phosphate	natural abundance		20 mM

3 2D 1H-1H TOCSY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
3	RNA	natural abundance		1.0 mM
4	Sodium Phosphate	natural abundance		20 mM

4 2D 1H-1H NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.1, Details 1.0 mM RNA, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
5	RNA	natural abundance		1.0 mM
6	Sodium Phosphate	natural abundance		20 mM

5 2D 1H-1H NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
7	RNA	natural abundance		1.0 mM
8	Sodium Phosphate	natural abundance		20 mM

6 2D 1H-1H NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.1, Details 1.0 mM RNA, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
9	RNA	natural abundance		1.0 mM
10	Sodium Phosphate	natural abundance		20 mM

7 2D 1H-1H NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM [A,G-98% D3', 4', 5', 5"; C,U-98% D3', 4', 5', 5", 5] RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
11	RNA	[A,G-98% D3', 4', 5', 5"; C,U-98% D3', 4', 5', 5", 5]		1.0 mM
12	Sodium Phosphate	natural abundance		20 mM

8 2D 1H-1H TOCSY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
7	RNA	natural abundance		1.0 mM
8	Sodium Phosphate	natural abundance		20 mM

9 2D 1H-13C HSQC

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM [A,C,G,U-98% 13C, A,C,G,U-98% 15N] RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
13	RNA	[A,C,G,U-98% 13C, A,C,G,U-98% 15N]		1.0 mM
14	Sodium Phosphate	natural abundance		20 mM

10 2D 1H-15N HSQC

Instrument

Bruker AvanceII - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.1, Details 1.0 mM [A,C,G,U-98% 13C, A,C,G,U-98% 15N] RNA, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
15	RNA	[A,C,G,U-98% 13C, A,C,G,U-98% 15N]		1.0 mM
16	Sodium Phosphate	natural abundance		20 mM

11 3D 1H-13C NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.1, Details 1.0 mM [A,C,G,U-98% 13C, A,C,G,U-98% 15N] RNA, 100% D2O

#	Name	Isotope labeling	Type	Concentration
13	RNA	[A,C,G,U-98% 13C, A,C,G,U-98% 15N]		1.0 mM
14	Sodium Phosphate	natural abundance		20 mM

Chemical shift validation 3 contents Detail

Properties

Input source #1: Assigned chemical shifts - Assigned chemical shifts	bmr30560_3.str
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	OK

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Content subtype: bmr30560_3.str

#	Content subtype	Saveframe	Status	# of rows	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	OK	707		100.0 (chain: 1, length: 56)
1	Chemical shift references	chem_shift_reference_1	OK	3		No information

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: OK

Sequence coverage of experimental data

Entity_assembly_ID: 1, Chain length: 56, Sequence coverage: 100.0%

--------10--------20--------30--------40--------50------
GGCAGUAUAGUCCGAACUGCAAAUCUUAUUUUCUUUUCACCUUCUCUCUAACUGCC
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GGCAGUAUAGUCCGAACUGCAAAUCUUAUUUUCUUUUCACCUUCUCUCUAACUGCC

Total number of assignments
- ¹H chemical shifts: 404
- ¹³C chemical shifts: 291
- ¹⁵N chemical shifts: 12

Completeness of assignments

Entity_assemble_ID: 1

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
2	G	H21	6.753
2	G	H22	5.43
4	A	H61	7.466
4	A	H62	6.046
5	G	H21	7.975
5	G	H22	5.732
9	A	H61	7.397
9	A	H62	6.091
10	G	H21	8.529
10	G	H22	5.923
14	G	H21	5.856
15	A	H61	7.692
15	A	H62	6.224
16	A	H62	6.546
54	G	H21	7.88
54	G	H22	5.636

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	501	388	77.4
¹³C chemical shifts	385	291	75.6
¹⁵N chemical shifts	28	12	42.9

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	336	265	78.9
¹³C chemical shifts	280	214	76.4

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	165	123	74.5
¹³C chemical shifts	105	77	73.3
¹⁵N chemical shifts	28	12	42.9

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	31	31	100.0
¹³C chemical shifts	31	25	80.6

Histogram of normalized assigned chemical shifts

Keywords RNA, c-JUN, cap-dependent, eIF3, mRNA, specialized translation initiation

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.36 seconds)

BMRB: 30560

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #6

Sample #7

Sample #8

Related entities 1. C-JUN TL, : 1 : 1 entities Detail

Experiments performed 11 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Chemical shift validation 3 contents Detail