BMRBj - BMREntryMaster

Found 1 Document (0.381 seconds)

BMRB: 30701

6VAR

61 nt human Hepatitis B virus epsilon pre-genomic RNA

Authors

LeBlanc, R.M., Kasprzak, W.K., Longhini, A.P., Abulwerdi, F., Ginocchio, S., Shields, B., Nyman, J., Svirydava, M., Del Vecchio, C., Ivanic, J., Schneekloth, J.S., Dayie, T.K., Shapiro, B.A., Le Grice, S.F.J.

Assembly

RNA (61-MER)

Entity

1. RNA (61-MER) (polymer, Thiol state: not present), 61 monomers, 19604.46 Da Detail

GGUUCAUGUC CUACUGUUCA AGCCUCCAAG CUGUGCCUUG GGUGGCUUUG GGGCAUGGAC C

Formula weight

19604.46 Da

Source organism

Hepatitis B virus

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chemcal Shifts

¹H: 283, ¹³C: 164, ¹⁵N: 27 assignments Detail

ID	Entity ID	Seq ID	Comp ID	Atom ID	Atom type	Val	Val err	Ambig. code
1	1	1	G	H1	H	12.82224	0.03	1
2	1	1	G	H1'	H	5.845910	0.03	1
3	1	1	G	H2'	H	4.967179	0.03	1
4	1	1	G	H3'	H	4.707860	0.03	1
5	1	1	G	H8	H	8.154649	0.03	1
6	1	1	G	C1'	C	91.70181	0.03	1
7	1	1	G	C8	C	139.1702	0.03	1
8	1	1	G	N1	N	147.3294	0.03	1
9	1	2	G	H1	H	13.42476	0.03	1
10	1	2	G	H1'	H	5.945300	0.03	1
11	1	2	G	H8	H	7.525829	0.03	1
12	1	2	G	C1'	C	93.12582	0.03	1
13	1	2	G	C8	C	136.8924	0.03	1
14	1	2	G	N1	N	148.2738	0.03	1
15	1	3	U	H1'	H	5.578409	0.03	1
16	1	3	U	H2'	H	4.701439	0.03	1
17	1	3	U	H3	H	14.33440	0.03	1
18	1	3	U	H5	H	5.109509	0.03	1
19	1	3	U	H6	H	7.686019	0.03	1
20	1	3	U	C1'	C	93.87701	0.03	1
21	1	3	U	C5	C	102.7949	0.03	1
22	1	3	U	C6	C	141.4423	0.03	1
23	1	3	U	N3	N	162.0316	0.03	1
24	1	4	U	H1'	H	5.542629	0.03	1
25	1	4	U	H2'	H	4.189499	0.03	1
26	1	4	U	H3	H	11.97617	0.03	1
27	1	4	U	H5	H	5.806659	0.03	1
28	1	4	U	H6	H	7.982179	0.03	1
29	1	4	U	C1'	C	94.19153	0.03	1
30	1	4	U	C5	C	104.8511	0.03	1
31	1	4	U	C6	C	141.3920	0.03	1
32	1	4	U	N3	N	158.6423	0.03	1
33	1	5	C	H1'	H	5.460609	0.03	1
34	1	5	C	H2'	H	4.475770	0.03	1
35	1	5	C	H5	H	5.710069	0.03	1
36	1	5	C	H6	H	7.940989	0.03	1
37	1	5	C	C1'	C	93.53410	0.03	1
38	1	5	C	C5	C	97.73734	0.03	1
39	1	5	C	C6	C	142.1365	0.03	1
40	1	6	A	H1'	H	5.836730	0.03	1
41	1	6	A	H2	H	7.296819	0.03	1
42	1	6	A	H2'	H	4.469729	0.03	1
43	1	6	A	H8	H	8.059339	0.03	1
44	1	6	A	C1'	C	93.00445	0.03	1
45	1	6	A	C2	C	153.1143	0.03	1
46	1	6	A	C8	C	139.6008	0.03	1
47	1	7	U	H1'	H	5.474979	0.03	1
48	1	7	U	H2'	H	4.424920	0.03	1
49	1	7	U	H3	H	13.37857	0.03	1
50	1	7	U	H5	H	5.053339	0.03	1
51	1	7	U	H6	H	7.652449	0.03	1
52	1	7	U	C1'	C	93.06483	0.03	1
53	1	7	U	C5	C	103.0934	0.03	1
54	1	7	U	C6	C	140.8736	0.03	1
55	1	7	U	N3	N	161.7825	0.03	1
56	1	8	G	H1	H	12.66868	0.03	1
57	1	8	G	H1'	H	5.780709	0.03	1
58	1	8	G	H8	H	7.620999	0.03	1
59	1	8	G	C1'	C	92.84521	0.03	1
60	1	8	G	C8	C	136.0487	0.03	1
61	1	8	G	N1	N	147.5177	0.03	1
62	1	9	U	H1'	H	5.418349	0.03	1
63	1	9	U	H2'	H	4.095779	0.03	1
64	1	9	U	H3	H	12.10226	0.03	1
65	1	9	U	H5	H	5.437789	0.03	1
66	1	9	U	H6	H	7.758059	0.03	1
67	1	9	U	C1'	C	93.49518	0.03	1
68	1	9	U	C5	C	103.9848	0.03	1
69	1	9	U	C6	C	140.4966	0.03	1
70	1	9	U	N3	N	158.8539	0.03	1
71	1	10	C	H1'	H	5.591229	0.03	1
72	1	10	C	H2'	H	4.371269	0.03	1
73	1	10	C	H5	H	5.622879	0.03	1
74	1	10	C	H6	H	7.912859	0.03	1
75	1	10	C	C1'	C	93.54990	0.03	1
76	1	10	C	C5	C	97.38779	0.03	1
77	1	10	C	C6	C	142.4142	0.03	1
78	1	11	C	H1'	H	5.420479	0.03	1
79	1	11	C	H2'	H	4.600160	0.03	1
80	1	11	C	H5	H	5.475979	0.03	1
81	1	11	C	H6	H	7.637419	0.03	1
82	1	11	C	C1'	C	94.16135	0.03	1
83	1	11	C	C5	C	97.77032	0.03	1
84	1	11	C	C6	C	141.3006	0.03	1
85	1	12	U	H1'	H	5.594709	0.03	1
86	1	12	U	H2'	H	4.296629	0.03	1
87	1	12	U	H3	H	11.55062	0.03	1
88	1	12	U	H5	H	5.667259	0.03	1
89	1	12	U	H6	H	7.800529	0.03	1
90	1	12	U	C1'	C	93.96120	0.03	1
91	1	12	U	C5	C	104.8542	0.03	1
92	1	12	U	C6	C	140.9984	0.03	1
93	1	12	U	N3	N	157.8262	0.03	1
94	1	13	A	H1'	H	5.790009	0.03	1
95	1	13	A	H2	H	7.499559	0.03	1
96	1	13	A	H2'	H	4.419320	0.03	1
97	1	13	A	H8	H	8.074309	0.03	1
98	1	13	A	C1'	C	92.62160	0.03	1
99	1	13	A	C2	C	154.2441	0.03	1
100	1	13	A	C8	C	139.9603	0.03	1
101	1	14	C	H1'	H	5.395050	0.03	1
102	1	14	C	H2'	H	3.998780	0.03	1
103	1	14	C	H3'	H	4.310209	0.03	1
104	1	14	C	H4'	H	4.228539	0.03	1
105	1	14	C	H5	H	5.290149	0.03	1
106	1	14	C	H6	H	7.356979	0.03	1
107	1	14	C	C1'	C	92.74543	0.03	1
108	1	14	C	C5	C	97.30749	0.03	1
109	1	14	C	C6	C	141.3385	0.03	1
110	1	15	U	H1'	H	5.663270	0.03	1
111	1	15	U	H2'	H	4.130139	0.03	1
112	1	15	U	H3'	H	4.453449	0.03	1
113	1	15	U	H4'	H	4.130139	0.03	1
114	1	15	U	H5	H	5.574139	0.03	1
115	1	15	U	H6	H	7.574129	0.03	1
116	1	15	U	C1'	C	90.86812	0.03	1
117	1	15	U	C5	C	105.0012	0.03	1
118	1	15	U	C6	C	142.8019	0.03	1
119	1	16	G	H1'	H	5.741709	0.03	1
120	1	16	G	H2'	H	4.767709	0.03	1
121	1	16	G	H3'	H	4.395380	0.03	1
122	1	16	G	H4'	H	4.395380	0.03	1
123	1	16	G	H5'	H	4.136169	0.03	1
124	1	16	G	H5''	H	4.065419	0.03	1
125	1	16	G	H8	H	7.856079	0.03	1
126	1	16	G	C1'	C	90.37031	0.03	1
127	1	16	G	C8	C	140.1743	0.03	1
128	1	17	U	H1'	H	5.836689	0.03	1
129	1	17	U	H2'	H	4.307809	0.03	1
130	1	17	U	H3'	H	4.570429	0.03	1
131	1	17	U	H4'	H	4.361690	0.03	1
132	1	17	U	H5	H	5.724069	0.03	1
133	1	17	U	H6	H	7.732749	0.03	1
134	1	17	U	C1'	C	90.79417	0.03	1
135	1	17	U	C5	C	105.1237	0.03	1
136	1	17	U	C6	C	143.6439	0.03	1
137	1	18	U	H1'	H	5.622339	0.03	1
138	1	18	U	H2'	H	4.241169	0.03	1
139	1	18	U	H3'	H	4.505390	0.03	1
140	1	18	U	H4'	H	4.241169	0.03	1
141	1	18	U	H5	H	5.652859	0.03	1
142	1	18	U	H6	H	7.569389	0.03	1
143	1	18	U	C1'	C	90.68884	0.03	1
144	1	18	U	C5	C	104.9253	0.03	1
145	1	18	U	C6	C	143.1878	0.03	1
146	1	19	C	H1'	H	5.804470	0.03	1
147	1	19	C	H2'	H	4.400400	0.03	1
148	1	19	C	H3'	H	4.445529	0.03	1
149	1	19	C	H4'	H	4.546730	0.03	1
150	1	19	C	H5	H	5.782679	0.03	1
151	1	19	C	H6	H	7.738689	0.03	1
152	1	19	C	C1'	C	92.26494	0.03	1
153	1	19	C	C5	C	98.61710	0.03	1
154	1	19	C	C6	C	142.8733	0.03	1
155	1	20	A	H1'	H	5.856509	0.03	1
156	1	20	A	H2	H	7.408799	0.03	1
157	1	20	A	H2'	H	4.735960	0.03	1
158	1	20	A	H8	H	8.289039	0.03	1
159	1	20	A	C1'	C	91.97820	0.03	1
160	1	20	A	C2	C	153.3234	0.03	1
161	1	20	A	C8	C	140.8097	0.03	1
162	1	21	A	H1'	H	5.936059	0.03	1
163	1	21	A	H2	H	7.645139	0.03	1
164	1	21	A	H2'	H	4.602640	0.03	1
165	1	21	A	H8	H	7.904229	0.03	1
166	1	21	A	C1'	C	92.37610	0.03	1
167	1	21	A	C2	C	153.4044	0.03	1
168	1	21	A	C8	C	139.5109	0.03	1
169	1	22	G	H1	H	13.50589	0.03	1
170	1	22	G	H1'	H	5.671410	0.03	1
171	1	22	G	H2'	H	4.395110	0.03	1
172	1	22	G	H8	H	7.283309	0.03	1
173	1	22	G	C1'	C	92.50014	0.03	1
174	1	22	G	C8	C	135.7187	0.03	1
175	1	22	G	N1	N	148.3392	0.03	1
176	1	23	C	H1'	H	5.533319	0.03	1
177	1	23	C	H2'	H	4.471879	0.03	1
178	1	23	C	H5	H	5.182459	0.03	1
179	1	23	C	H6	H	7.581649	0.03	1
180	1	23	C	C1'	C	93.69749	0.03	1
181	1	23	C	C5	C	97.10290	0.03	1
182	1	23	C	C6	C	140.7653	0.03	1
183	1	24	C	H1'	H	5.539809	0.03	1
184	1	24	C	H2'	H	4.471039	0.03	1
185	1	24	C	H5	H	5.520459	0.03	1
186	1	24	C	H6	H	7.586589	0.03	1
187	1	24	C	C1'	C	94.30630	0.03	1
188	1	24	C	C5	C	98.18869	0.03	1
189	1	24	C	C6	C	140.8969	0.03	1
190	1	25	U	H1'	H	5.636549	0.03	1
191	1	25	U	H2'	H	4.143680	0.03	1
192	1	25	U	H3	H	11.79961	0.03	1
193	1	25	U	H5	H	5.696819	0.03	1
194	1	25	U	H6	H	7.946319	0.03	1
195	1	25	U	C1'	C	93.90043	0.03	1
196	1	25	U	C5	C	104.6092	0.03	1
197	1	25	U	C6	C	141.3237	0.03	1
198	1	25	U	N3	N	158.2975	0.03	1
199	1	26	C	H1'	H	5.464610	0.03	1
200	1	26	C	H2'	H	4.558740	0.03	1
201	1	26	C	H5	H	5.722379	0.03	1
202	1	26	C	H6	H	8.008209	0.03	1
203	1	26	C	C1'	C	93.58891	0.03	1
204	1	26	C	C5	C	97.32648	0.03	1
205	1	26	C	C6	C	142.4066	0.03	1
206	1	27	C	H1'	H	5.365309	0.03	1
207	1	27	C	H2'	H	4.471709	0.03	1
208	1	27	C	H5	H	5.515099	0.03	1
209	1	27	C	H6	H	7.716819	0.03	1
210	1	27	C	C1'	C	94.10892	0.03	1
211	1	27	C	C5	C	97.66607	0.03	1
212	1	27	C	C6	C	141.2102	0.03	1
213	1	28	A	H1'	H	5.848279	0.03	1
214	1	28	A	H2	H	6.728899	0.03	1
215	1	28	A	H2'	H	4.674669	0.03	1
216	1	28	A	H8	H	8.014009	0.03	1
217	1	28	A	C1'	C	92.80153	0.03	1
218	1	28	A	C2	C	152.2548	0.03	1
219	1	28	A	C8	C	139.7120	0.03	1
220	1	29	A	H1'	H	5.804209	0.03	1
221	1	29	A	H2	H	7.323409	0.03	1
222	1	29	A	H2'	H	4.526059	0.03	1
223	1	29	A	H8	H	7.703079	0.03	1
224	1	29	A	C1'	C	92.66891	0.03	1
225	1	29	A	C2	C	152.8664	0.03	1
226	1	29	A	C8	C	138.9833	0.03	1
227	1	30	G	H1	H	13.32738	0.03	1
228	1	30	G	H1'	H	5.577499	0.03	1
229	1	30	G	H2'	H	4.124159	0.03	1
230	1	30	G	H8	H	7.249329	0.03	1
231	1	30	G	C1'	C	93.11047	0.03	1
232	1	30	G	C8	C	135.9917	0.03	1
233	1	30	G	N1	N	147.8721	0.03	1
234	1	31	C	H1'	H	5.833439	0.03	1
235	1	31	C	H2'	H	4.262350	0.03	1
236	1	31	C	H5	H	5.162519	0.03	1
237	1	31	C	H6	H	7.465869	0.03	1
238	1	31	C	C1'	C	91.49982	0.03	1
239	1	31	C	C5	C	97.93303	0.03	1
240	1	31	C	C6	C	141.7926	0.03	1
241	1	32	U	H1'	H	5.770979	0.03	1
242	1	32	U	H2'	H	4.283410	0.03	1
243	1	32	U	H3'	H	4.539760	0.03	1
244	1	32	U	H4'	H	4.007050	0.03	1
245	1	32	U	H5	H	5.799279	0.03	1
246	1	32	U	H6	H	7.749789	0.03	1
247	1	32	U	C1'	C	91.17473	0.03	1
248	1	32	U	C5	C	105.0856	0.03	1
249	1	32	U	C6	C	143.4497	0.03	1
250	1	33	G	H1'	H	5.725840	0.03	1
251	1	33	G	H2'	H	4.817669	0.03	1
252	1	33	G	H3'	H	4.701310	0.03	1
253	1	33	G	H4'	H	4.390009	0.03	1
254	1	33	G	H8	H	7.917499	0.03	1
255	1	33	G	C1'	C	89.21272	0.03	1
256	1	33	G	C8	C	140.5584	0.03	1
257	1	34	U	H1'	H	5.540839	0.03	1
258	1	34	U	H2'	H	4.078789	0.03	1
259	1	34	U	H3'	H	4.479300	0.03	1
260	1	34	U	H4'	H	3.750710	0.03	1
261	1	34	U	H5	H	5.665920	0.03	1
262	1	34	U	H6	H	7.590319	0.03	1
263	1	34	U	C1'	C	89.47890	0.03	1
264	1	34	U	C5	C	105.1020	0.03	1
265	1	34	U	C6	C	143.4461	0.03	1
266	1	35	G	H1	H	13.11321	0.03	1
267	1	35	G	H1'	H	5.851500	0.03	1
268	1	35	G	H2'	H	4.872069	0.03	1
269	1	35	G	H3'	H	4.975160	0.03	1
270	1	35	G	H4'	H	4.411590	0.03	1
271	1	35	G	H8	H	7.840099	0.03	1
272	1	35	G	C1'	C	88.75290	0.03	1
273	1	35	G	C8	C	138.1199	0.03	1
274	1	35	G	N1	N	148.5184	0.03	1
275	1	36	C	H1'	H	5.992889	0.03	1
276	1	36	C	H2'	H	4.541589	0.03	1
277	1	36	C	H3'	H	4.728809	0.03	1
278	1	36	C	H4'	H	4.460909	0.03	1
279	1	36	C	H5	H	6.098899	0.03	1
280	1	36	C	H5'	H	4.406829	0.03	1
281	1	36	C	H5''	H	4.266409	0.03	1
282	1	36	C	H6	H	7.845269	0.03	1
283	1	36	C	C1'	C	93.64917	0.03	1
284	1	36	C	C5	C	99.25106	0.03	1
285	1	36	C	C6	C	144.6453	0.03	1
286	1	37	C	H1'	H	5.432419	0.03	1
287	1	37	C	H2'	H	4.479119	0.03	1
288	1	37	C	H5	H	5.557109	0.03	1
289	1	37	C	H6	H	7.682019	0.03	1
290	1	37	C	C1'	C	94.72085	0.03	1
291	1	37	C	C5	C	97.85733	0.03	1
292	1	37	C	C6	C	141.4204	0.03	1
293	1	38	U	H1'	H	5.591409	0.03	1
294	1	38	U	H2'	H	4.509109	0.03	1
295	1	38	U	H3	H	14.28961	0.03	1
296	1	38	U	H5	H	5.488339	0.03	1
297	1	38	U	H6	H	8.008209	0.03	1
298	1	38	U	C1'	C	93.83910	0.03	1
299	1	38	U	C5	C	103.0733	0.03	1
300	1	38	U	C6	C	142.4066	0.03	1
301	1	38	U	N3	N	162.5342	0.03	1
302	1	39	U	H1'	H	5.623109	0.03	1
303	1	39	U	H3	H	13.11050	0.03	1
304	1	39	U	H5	H	5.601229	0.03	1
305	1	39	U	H6	H	7.932199	0.03	1
306	1	39	U	C1'	C	93.20421	0.03	1
307	1	39	U	C5	C	103.7324	0.03	1
308	1	39	U	C6	C	141.8118	0.03	1
309	1	39	U	N3	N	162.1286	0.03	1
310	1	40	G	H1	H	11.95811	0.03	1
311	1	40	G	H1'	H	5.736949	0.03	1
312	1	40	G	H2'	H	4.641989	0.03	1
313	1	40	G	H8	H	7.654309	0.03	1
314	1	40	G	C1'	C	92.55176	0.03	1
315	1	40	G	C8	C	136.2042	0.03	1
316	1	40	G	N1	N	146.4648	0.03	1
317	1	41	G	H1	H	12.82495	0.03	1
318	1	41	G	H1'	H	5.577499	0.03	1
319	1	41	G	H2'	H	4.517640	0.03	1
320	1	41	G	H8	H	7.024369	0.03	1
321	1	41	G	C1'	C	93.17580	0.03	1
322	1	41	G	C8	C	136.1652	0.03	1
323	1	41	G	N1	N	148.3398	0.03	1
324	1	42	G	H1	H	10.57704	0.03	1
325	1	42	G	H1'	H	5.806659	0.03	1
326	1	42	G	H2'	H	4.395999	0.03	1
327	1	42	G	H3'	H	4.615230	0.03	1
328	1	42	G	H4'	H	4.518439	0.03	1
329	1	42	G	H8	H	7.434979	0.03	1
330	1	42	G	C1'	C	90.02773	0.03	1
331	1	42	G	C8	C	137.9610	0.03	1
332	1	42	G	N1	N	145.2740	0.03	1
333	1	43	U	H1'	H	5.793400	0.03	1
334	1	43	U	H5	H	5.803609	0.03	1
335	1	43	U	H6	H	7.849399	0.03	1
336	1	43	U	C1'	C	92.64800	0.03	1
337	1	43	U	C5	C	104.5443	0.03	1
338	1	43	U	C6	C	143.6278	0.03	1
339	1	44	G	H1	H	12.82083	0.03	1
340	1	44	G	H1'	H	5.783309	0.03	1
341	1	44	G	H8	H	7.630329	0.03	1
342	1	44	G	C1'	C	92.69250	0.03	1
343	1	44	G	C8	C	137.2991	0.03	1
344	1	44	G	N1	N	147.9276	0.03	1
345	1	45	G	H1	H	13.19511	0.03	1
346	1	45	G	H1'	H	5.853129	0.03	1
347	1	45	G	H2'	H	4.641049	0.03	1
348	1	45	G	H8	H	7.446099	0.03	1
349	1	45	G	C1'	C	93.26429	0.03	1
350	1	45	G	C8	C	136.8036	0.03	1
351	1	45	G	N1	N	148.6907	0.03	1
352	1	46	C	H1'	H	5.592690	0.03	1
353	1	46	C	H2'	H	4.460839	0.03	1
354	1	46	C	H5	H	5.252879	0.03	1
355	1	46	C	H6	H	7.693019	0.03	1
356	1	46	C	C1'	C	94.25899	0.03	1
357	1	46	C	C5	C	97.12626	0.03	1
358	1	46	C	C6	C	141.2564	0.03	1
359	1	47	U	H1'	H	5.662179	0.03	1
360	1	47	U	H2'	H	4.332600	0.03	1
361	1	47	U	H3	H	14.12032	0.03	1
362	1	47	U	H5	H	5.484569	0.03	1
363	1	47	U	H6	H	7.914719	0.03	1
364	1	47	U	C1'	C	93.93900	0.03	1
365	1	47	U	C5	C	103.6947	0.03	1
366	1	47	U	C6	C	142.1564	0.03	1
367	1	47	U	N3	N	162.1500	0.03	1
368	1	48	U	H1'	H	5.949059	0.03	1
369	1	48	U	H2'	H	4.311180	0.03	1
370	1	48	U	H3'	H	4.642179	0.03	1
371	1	48	U	H4'	H	4.457260	0.03	1
372	1	48	U	H5	H	5.672219	0.03	1
373	1	48	U	H6	H	7.880959	0.03	1
374	1	48	U	C1'	C	91.79278	0.03	1
375	1	48	U	C5	C	104.2601	0.03	1
376	1	48	U	C6	C	143.0826	0.03	1
377	1	49	U	H1'	H	5.945699	0.03	1
378	1	49	U	H2'	H	4.464540	0.03	1
379	1	49	U	H3'	H	4.712190	0.03	1
380	1	49	U	H4'	H	4.498330	0.03	1
381	1	49	U	H5	H	5.799279	0.03	1
382	1	49	U	H6	H	7.844599	0.03	1
383	1	49	U	C1'	C	90.90185	0.03	1
384	1	49	U	C5	C	105.0856	0.03	1
385	1	49	U	C6	C	143.4464	0.03	1
386	1	50	G	H1	H	10.40551	0.03	1
387	1	50	G	H1'	H	5.784989	0.03	1
388	1	50	G	H2'	H	4.748879	0.03	1
389	1	50	G	H8	H	7.973239	0.03	1
390	1	50	G	C1'	C	93.17482	0.03	1
391	1	50	G	C8	C	138.3824	0.03	1
392	1	50	G	N1	N	142.5716	0.03	1
393	1	51	G	H1	H	12.61196	0.03	1
394	1	51	G	H1'	H	5.694419	0.03	1
395	1	51	G	H2'	H	4.680900	0.03	1
396	1	51	G	H8	H	7.238919	0.03	1
397	1	51	G	C1'	C	92.75845	0.03	1
398	1	51	G	C8	C	136.3379	0.03	1
399	1	51	G	N1	N	147.2618	0.03	1
400	1	52	G	H1	H	12.67999	0.03	1
401	1	52	G	H1'	H	5.800709	0.03	1
402	1	52	G	H8	H	7.224719	0.03	1
403	1	52	G	C1'	C	92.76961	0.03	1
404	1	52	G	C8	C	136.3137	0.03	1
405	1	52	G	N1	N	148.1878	0.03	1
406	1	53	G	H1	H	11.31656	0.03	1
407	1	53	G	H1'	H	5.788640	0.03	1
408	1	53	G	H2'	H	4.597179	0.03	1
409	1	53	G	H8	H	7.237809	0.03	1
410	1	53	G	C1'	C	93.39040	0.03	1
411	1	53	G	C8	C	136.7678	0.03	1
412	1	53	G	N1	N	145.2239	0.03	1
413	1	54	C	H1'	H	5.492229	0.03	1
414	1	54	C	H2'	H	4.478809	0.03	1
415	1	54	C	H5	H	5.358669	0.03	1
416	1	54	C	H6	H	7.668289	0.03	1
417	1	54	C	C1'	C	93.72730	0.03	1
418	1	54	C	C5	C	97.64150	0.03	1
419	1	54	C	C6	C	140.2753	0.03	1
420	1	55	A	H1'	H	5.945300	0.03	1
421	1	55	A	H2	H	7.282219	0.03	1
422	1	55	A	H2'	H	4.459089	0.03	1
423	1	55	A	H8	H	8.059339	0.03	1
424	1	55	A	C1'	C	93.12582	0.03	1
425	1	55	A	C2	C	153.1143	0.03	1
426	1	55	A	C8	C	139.6008	0.03	1
427	1	56	U	H1'	H	5.444759	0.03	1
428	1	56	U	H2'	H	4.488619	0.03	1
429	1	56	U	H3	H	13.37857	0.03	1
430	1	56	U	H5	H	5.039559	0.03	1
431	1	56	U	H6	H	7.652449	0.03	1
432	1	56	U	C1'	C	92.91997	0.03	1
433	1	56	U	C5	C	102.9845	0.03	1
434	1	56	U	C6	C	140.8736	0.03	1
435	1	56	U	N3	N	161.7825	0.03	1
436	1	57	G	H1	H	11.88781	0.03	1
437	1	57	G	H1'	H	5.842109	0.03	1
438	1	57	G	H2'	H	4.522180	0.03	1
439	1	57	G	H8	H	7.657119	0.03	1
440	1	57	G	C1'	C	91.77470	0.03	1
441	1	57	G	C8	C	136.2916	0.03	1
442	1	57	G	N1	N	146.9968	0.03	1
443	1	58	G	H1	H	10.44799	0.03	1
444	1	58	G	H1'	H	5.639559	0.03	1
445	1	58	G	H2'	H	4.741930	0.03	1
446	1	58	G	H8	H	7.113069	0.03	1
447	1	58	G	C1'	C	93.54867	0.03	1
448	1	58	G	C8	C	136.9862	0.03	1
449	1	58	G	N1	N	142.6818	0.03	1
450	1	59	A	H1'	H	5.945300	0.03	1
451	1	59	A	H2	H	7.914609	0.03	1
452	1	59	A	H2'	H	4.546609	0.03	1
453	1	59	A	H8	H	7.799589	0.03	1
454	1	59	A	C1'	C	93.12582	0.03	1
455	1	59	A	C2	C	154.2077	0.03	1
456	1	59	A	C8	C	139.2007	0.03	1
457	1	60	C	H1'	H	5.411659	0.03	1
458	1	60	C	H2'	H	4.097239	0.03	1
459	1	60	C	H3'	H	4.485630	0.03	1
460	1	60	C	H4'	H	4.367630	0.03	1
461	1	60	C	H5	H	5.174499	0.03	1
462	1	60	C	H6	H	7.451069	0.03	1
463	1	60	C	C1'	C	94.36143	0.03	1
464	1	60	C	C5	C	96.96023	0.03	1
465	1	60	C	C6	C	140.7997	0.03	1
466	1	61	C	H1'	H	6.119410	0.03	1
467	1	61	C	H2'	H	4.636250	0.03	1
468	1	61	C	H3'	H	4.943299	0.03	1
469	1	61	C	H4'	H	4.413740	0.03	1
470	1	61	C	H5	H	5.471359	0.03	1
471	1	61	C	H6	H	7.465869	0.03	1
472	1	61	C	C1'	C	91.96461	0.03	1
473	1	61	C	C5	C	99.04430	0.03	1
474	1	61	C	C6	C	141.7926	0.03	1

Release date

2020-01-16

Citation

Structural insights of the conserved "priming loop" of hepatitis B virus pre-genomic RNA
LeBlanc, R.M., Kasprzak, W.K., Longhini, A.P., Olenginski, L.T., Abulwerdi, F., Ginocchio, S., Shields, B., Nyman, J., Svirydava, M., Del Vecchio, C., Ivanic, J., Schneekloth, J.S., Shapiro, B.A., Dayie, T.K., Le Grice, S.
J. Biomol. Struct. Dyn. (2022), 40, 9761-9773, PubMed 34155954 , DOI 10.1080/07391102.2021.1934544 , Abstract

Related entities 1. RNA (61-MER), : 1 entities Detail

Experiments performed 11 experiments Detail

1 2D 1H-15N HSQC

Instrument

Bruker Ascend - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 0.8 mM, selective labeled [U-13C; U-15N], A, C, G, U; RNA (61-MER), 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
2	RNA (61-MER)	[U-13C; U-15N]		0.8 mM

2 2D 1H-13C HSQC aliphatic

Instrument

Bruker Ascend - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 0.8 mM, Fully Labeled [U-13C; U-15N] RNA (61-MER), 100% D2O

#	Name	Isotope labeling	Type	Concentration
1	RNA (61-MER)	[U-13C; U-15N]		0.8 mM

3 2D 1H-13C HSQC aromatic

Instrument

Bruker Ascend - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 0.8 mM, Fully Labeled [U-13C; U-15N] RNA (61-MER), 100% D2O

#	Name	Isotope labeling	Type	Concentration
1	RNA (61-MER)	[U-13C; U-15N]		0.8 mM

4 3D 1H-15N NOESY

Instrument

Bruker Ascend - 800 MHz

Sample

#	Name	Isotope labeling	Type	Concentration
2	RNA (61-MER)	[U-13C; U-15N]		0.8 mM

5 3D 1H-13C NOESY aliphatic

Instrument

Bruker Ascend - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 0.8 mM, Fully Labeled [U-13C; U-15N] RNA (61-MER), 100% D2O

#	Name	Isotope labeling	Type	Concentration
1	RNA (61-MER)	[U-13C; U-15N]		0.8 mM

6 3D 1H-13C NOESY aromatic

Instrument

Bruker Ascend - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 0.8 mM, Fully Labeled [U-13C; U-15N] RNA (61-MER), 100% D2O

#	Name	Isotope labeling	Type	Concentration
1	RNA (61-MER)	[U-13C; U-15N]		0.8 mM

7 2D 1H-1H NOESY

Instrument

Bruker Ultrashield Plus - 600 MHz

Sample

#	Name	Isotope labeling	Type	Concentration
2	RNA (61-MER)	[U-13C; U-15N]		0.8 mM

8 2D 1H-1H NOESY

Instrument

Bruker Ultrashield Plus - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 0.8 mM, Fully Labeled [U-13C; U-15N] RNA (61-MER), 100% D2O

#	Name	Isotope labeling	Type	Concentration
1	RNA (61-MER)	[U-13C; U-15N]		0.8 mM

9 3D HCN

Instrument

Bruker Ascend - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 0.8 mM, Fully Labeled [U-13C; U-15N] RNA (61-MER), 100% D2O

#	Name	Isotope labeling	Type	Concentration
1	RNA (61-MER)	[U-13C; U-15N]		0.8 mM

10 2D HNCCNCH

Instrument

Bruker Ascend - 800 MHz

Sample

#	Name	Isotope labeling	Type	Concentration
2	RNA (61-MER)	[U-13C; U-15N]		0.8 mM

11 Filter/Edit NOESY

Instrument

Bruker Ascend - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 0.7 mM 13C-selective RNA (61-MER), 13C-1',6-UC; 13C-1',8-G; 13C-2',8-A; 100% D2O

#	Name	Isotope labeling	Type	Concentration
3	RNA (61-MER)	13C-selective		0.7 mM

NMR combined restraints 6 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_30701_6var.nef
Input source #2: Coordindates	6var.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30--------40--------50--------60-
GGUUCAUGUCCUACUGUUCAAGCCUCCAAGCUGUGCCUUGGGUGGCUUUGGGGCAUGGACC
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GGUUCAUGUCCUACUGUUCAAGCCUCCAAGCUGUGCCUUGGGUGGCUUUGGGGCAUGGACC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	61	0	0	100.0

Content subtype: combined_30701_6var.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	474		100.0 (chain: A, length: 61)
1	Distance restraints	CNS/XPLOR_distance_constraints_7	OK	543 (1)	noe	100.0 (chain: A, length: 61)
2	Distance restraints	CNS/XPLOR_distance_constraints_8	OK	108 (1)	hbond	68.9 (chain: A, length: 61)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_6	OK	420 (420)	.	91.8 (chain: A, length: 61)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_4	Warning	47 (47)	.	70.5 (chain: A, length: 61)

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 61, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 283
  - ¹³C chemical shifts: 164
  - ¹⁵N chemical shifts: 27
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	538	283	52.6
¹³C chemical shifts	408	164	40.2
¹⁵N chemical shifts	37	27	73.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	366	153	41.8
¹³C chemical shifts	305	61	20.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	172	130	75.6
¹³C chemical shifts	103	103	100.0
¹⁵N chemical shifts	37	27	73.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	35	35	100.0
¹³C chemical shifts	35	35	100.0

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_7
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 61, Sequence coverage: 100.0%
- Total number of restraints: 543
- Weight of restraints: 1.0 (543)
- Potential type of restraints: square-well-parabolic (543)
- Range of distance target values: 2.3, 5.2 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_8
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 61, Sequence coverage: 68.9%
  - Total number of restraints: 108
  - Weight of restraints: 1.0 (108)
  - Potential type of restraints: square-well-parabolic (108)
  - Range of distance target values: 1.9, 2.8 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_6
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 61, Sequence coverage: 91.8%
- Total number of restraints: 420
- Total number of restraints per polymer type: 420
- Weight of restraints: 1.0 (420)
- Potential type of restraints: square-well-parabolic (420)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_4
- Status: Warning
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 61, Sequence coverage: 70.5%
- Total number of restraints: 47
- Potential type of restraints: undefined (47)
- Range of observed RDC values: 100.0, -100.0 (Hz)
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords RNA, non-coding RNA, viral RNA

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.381 seconds)

BMRB: 30701

Related entities 1. RNA (61-MER), : 1 entities Detail

Experiments performed 11 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 6 contents Detail