BMRBj - BMREntryMaster

Found 1 Document (0.329 seconds)

BMRB: 34221

6FC9

The 1,8-bis(aminomethyl)anthracene and Quadruplex-duplex junction complex

Authors

Santana, A., Serrano, I., Montalvillo-Jimenez, L., Corzana, F., Bastida, A., Jimenez-Barbero, J., Gonzalez, C., Asensio, J.L.

Assembly

DNA (27-MER)

Entity

1. DNA (27-MER), entity 1 (polymer, Thiol state: not present), 27 monomers, 8508.375 Da Detail

GGTTGGCGCG AAGCATTCGC GGGTTGG

2. DNA (27-MER), entity D5B (non-polymer), 238.328 Da

Total weight

8746.703 Da

Max. entity weight

8508.375 Da

Source organism

synthetic construct

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 76.1 %, Completeness (bb): 69.8 % Detail

Polymer type: polydeoxyribonucleotide

	Total	¹H
All	76.1 % (197 of 259)	76.1 % (197 of 259)
Suger, PO4	69.8 % (132 of 189)	69.8 % (132 of 189)
Nucleobase	92.9 % (65 of 70)	92.9 % (65 of 70)
Aromatic	94.4 % (51 of 54)	94.4 % (51 of 54)
Methyl	100.0 % (6 of 6)	100.0 % (6 of 6)

1. entity 1

GGTTGGCGCG AAGCATTCGC GGGTTGG

Show sample condition

Sample

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.9, Details 0.5 mM NA JQ2, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
1	JQ2	natural abundance	0.5 mM
2	KPi	natural abundance	20 mM
3	KCl	natural abundance	20 mM

Release date

2018-01-15

Citation

De Novo Design of Selective Quadruplex-Duplex Junction Ligands and Structural Characterisation of Their Binding Mode: Targeting the G4 Hot-Spot
Diaz-Casado, L., Serrano-Chacon, I., Montalvillo-Jimenez, L., Corzana, F., Bastida, A., Santana, A.G., Gonzalez, C., Asensio, J.L.
Chemistry (2021), 27, 6204-6212, PubMed 33368678 , DOI 10.1002/chem.202005026 , Abstract

Experiments performed 4 experiments Detail

NMR combined restraints 3 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints	combined_34221_6fc9.nef
Input source #2: Coordindates	6fc9.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
B	1	D5B	[8-(azaniumylmethyl)anthracen-1-yl]methylazanium	Assigned chemical shifts

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20-------
GGTTGGCGCGAAGCATTCGCGGGTTGG
|||||||||||||||||||||||||||
GGTTGGCGCGAAGCATTCGCGGGTTGG

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	27	0	0	100.0

Content subtype: combined_34221_6fc9.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	221		100.0 (chain: A, length: 27), 100.0 (chain: B, length: 1)
1	Distance restraints	DYANA/DIANA_distance_constraints_2	OK	215 (1)	noe	100.0 (chain: A, length: 27)

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 100.0%
  - Entity_assembly_ID: B, Chain length: 1, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 219
  - ¹⁵N chemical shifts: 2
- Completeness of assignments
  - Entity_assemble_ID: A
  - Entity_assemble_ID: B
- Histogram of normalized assigned chemical shifts

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
5	DG	H21	6.574
5	DG	H22	9.25
6	DG	H21	5.928
6	DG	H22	10.277
22	DG	H21	7.243
22	DG	H22	9.546
26	DG	H21	6.867
26	DG	H22	9.592
27	DG	H21	6.697
27	DG	H22	9.334

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	259	197	76.1

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	189	132	69.8

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	70	65	92.9

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	6	6	100.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	19	19	100.0

Comp_index_ID	Comp_ID
1	D5B

Distance restraints

Saveframe: DYANA/DIANA_distance_constraints_2
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 100.0%
- Total number of restraints: 215
- Weight of restraints: 1.0 (215)
- Potential type of restraints: upper-bound-parabolic (215)
- Range of distance target values: 2.5, 6.5 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
  - Chain_ID: B
    None
- Distance restraints on contact map

Keywords DNA, Junction, Quadruplex, ligand-DNA complex, non canonical DNA strucute

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.329 seconds)

BMRB: 34221

Sample

Experiments performed 4 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 3 contents Detail