BMRBj - BMREntryMaster

ID	Entity ID	Seq ID	Comp ID	Atom ID	Atom type	Val	Val err	Ambig. code
1	1	1	G	H1	H	11.622	0.002	1
2	1	1	G	H1'	H	5.858	0.001	1
3	1	1	G	H2'	H	4.900	0.001	1
4	1	1	G	H3'	H	4.711	0.002	1
5	1	1	G	H4'	H	4.479	0.002	1
6	1	1	G	H8	H	8.005	0.001	1
7	1	1	G	C8	C	137.831		1
8	1	2	DG	H1	H	11.341	0.002	1
9	1	2	DG	H1'	H	6.242	0.003	1
10	1	2	DG	H2'	H	2.709	0.001	1
11	1	2	DG	H2''	H	2.613	0.005	1
12	1	2	DG	H3'	H	4.972	0.002	1
13	1	2	DG	H4'	H	4.546	0.001	1
14	1	2	DG	H8	H	7.745	0.001	1
15	1	2	DG	C8	C	137.978		1
16	1	3	DG	H1	H	11.212	0.001	1
17	1	3	DG	H1'	H	6.173	0.004	1
18	1	3	DG	H2'	H	2.696	0.005	1
19	1	3	DG	H2''	H	2.594	0.002	1
20	1	3	DG	H3'	H	5.008	0.002	1
21	1	3	DG	H4'	H	4.164	0.001	1
22	1	3	DG	H8	H	7.658	0.001	1
23	1	3	DG	C8	C	137.490		1
24	1	4	DA	H1'	H	6.604	0.001	1
25	1	4	DA	H2	H	8.316	0.003	1
26	1	4	DA	H2'	H	2.921	0.005	1
27	1	4	DA	H2''	H	2.919	0.002	1
28	1	4	DA	H3'	H	4.879	0.001	1
29	1	4	DA	H4'	H	4.631	0.002	1
30	1	4	DA	H8	H	8.586	0.001	1
31	1	4	DA	C8	C	142.641		1
32	1	5	DT	H1'	H	6.575	0.002	1
33	1	5	DT	H2'	H	2.633	0.001	1
34	1	5	DT	H2''	H	2.633	0.001	1
35	1	5	DT	H3'	H	5.048	0.002	1
36	1	5	DT	H4'	H	4.515	0.002	1
37	1	5	DT	H6	H	7.874	0.001	1
38	1	5	DT	H71	H	2.056	0.001	1
39	1	5	DT	H72	H	2.056	0.001	1
40	1	5	DT	H73	H	2.056	0.001	1
41	1	5	DT	C6	C	140.198		1
42	1	6	DG	H1	H	11.557	0.001	1
43	1	6	DG	H1'	H	6.118	0.002	1
44	1	6	DG	H2'	H	2.521	0.001	1
45	1	6	DG	H2''	H	2.982	0.001	1
46	1	6	DG	H3'	H	4.987	0.001	1
47	1	6	DG	H4'	H	4.441	0.003	1
48	1	6	DG	H8	H	7.964	0.001	1
49	1	6	DG	C8	C	138.326		1
50	1	7	DG	H1	H	11.408	0.002	1
51	1	7	DG	H1'	H	5.952	0.002	1
52	1	7	DG	H2'	H	2.702	0.002	1
53	1	7	DG	H2''	H	2.753	0.002	1
54	1	7	DG	H3'	H	5.095	0.001	1
55	1	7	DG	H4'	H	4.442	0.003	1
56	1	7	DG	H8	H	7.770	0.001	1
57	1	7	DG	C8	C	137.490		1
58	1	8	DG	H1	H	11.152	0.003	1
59	1	8	DG	H1'	H	5.880	0.003	1
60	1	8	DG	H2'	H	2.112	0.002	1
61	1	8	DG	H2''	H	2.386	0.001	1
62	1	8	DG	H3'	H	4.943	0.002	1
63	1	8	DG	H4'	H	4.419	0.004	1
64	1	8	DG	H8	H	7.489	0.001	1
65	1	8	DG	C8	C	136.725		1
66	1	9	DA	H1'	H	6.084	0.002	1
67	1	9	DA	H2	H	7.583	0.002	1
68	1	9	DA	H2'	H	2.697	0.005	1
69	1	9	DA	H2''	H	2.565	0.004	1
70	1	9	DA	H3'	H	4.966	0.003	1
71	1	9	DA	H4'	H	4.425	0.001	1
72	1	9	DA	H8	H	8.078	0.001	1
73	1	9	DA	C8	C	141.729		1
74	1	10	DC	H1'	H	5.844	0.003	1
75	1	10	DC	H2'	H	2.156	0.005	1
76	1	10	DC	H2''	H	1.773	0.003	1
77	1	10	DC	H3'	H	4.590	0.003	1
78	1	10	DC	H4'	H	3.951	0.001	1
79	1	10	DC	H5	H	5.917		1
80	1	10	DC	H6	H	7.573	0.001	1
81	1	10	DC	C6	C	143.441		1
82	1	11	DA	H1'	H	5.778	0.002	1
83	1	11	DA	H2	H	7.728	0.002	1
84	1	11	DA	H2'	H	2.363	0.005	1
85	1	11	DA	H2''	H	2.123	0.004	1
86	1	11	DA	H3'	H	4.511		1
87	1	11	DA	H4'	H	3.944	0.007	1
88	1	11	DA	H8	H	7.862	0.001	1
89	1	11	DA	C8	C	141.646		1
90	1	12	DC	H1'	H	5.517	0.003	1
91	1	12	DC	H2'	H	1.768	0.01	1
92	1	12	DC	H2''	H	2.021	0.006	1
93	1	12	DC	H3'	H	4.374	0.001	1
94	1	12	DC	H5	H	5.263	0.002	1
95	1	12	DC	H6	H	7.089	0.001	1
96	1	12	DC	C6	C	143.928		1
97	1	13	DA	H1'	H	5.756	0.003	1
98	1	13	DA	H2	H	7.786	0.002	1
99	1	13	DA	H2'	H	2.275	0.002	1
100	1	13	DA	H2''	H	2.625	0.002	1
101	1	13	DA	H8	H	7.879	0.002	1
102	1	13	DA	C8	C	141.367		1
103	1	14	DG	H1	H	11.401	0.004	1
104	1	14	DG	H1'	H	6.052	0.002	1
105	1	14	DG	H2'	H	3.701	0.007	1
106	1	14	DG	H2''	H	3.114	0.001	1
107	1	14	DG	H3'	H	4.441	0.001	1
108	1	14	DG	H8	H	7.234	0.001	1
109	1	14	DG	C8	C	141.318		1
110	1	15	DG	H1	H	11.458	0.002	1
111	1	15	DG	H1'	H	5.812	0.005	1
112	1	15	DG	H2'	H	2.922	0.004	1
113	1	15	DG	H2''	H	2.802	0.001	1
114	1	15	DG	H3'	H	5.037	0.001	1
115	1	15	DG	H8	H	7.339	0.001	1
116	1	15	DG	C8	C	140.692		1
117	1	16	DG	H1	H	11.036	0.004	1
118	1	16	DG	H1'	H	5.867	0.003	1
119	1	16	DG	H2'	H	2.672	0.004	1
120	1	16	DG	H2''	H	2.361	0.003	1
121	1	16	DG	H3'	H	5.009	0.001	1
122	1	16	DG	H4'	H	4.304	0.002	1
123	1	16	DG	H8	H	7.547	0.002	1
124	1	16	DG	C8	C	141.388		1
125	1	17	DG	H1'	H	5.629	0.002	1
126	1	17	DG	H2'	H	2.299	0.001	2
127	1	17	DG	H2''	H	2.354	0.003	2
128	1	17	DG	H8	H	7.766	0.001	1
129	1	18	DA	H1'	H	6.044	0.002	1
130	1	18	DA	H2	H	7.805	0.002	1
131	1	18	DA	H2'	H	2.349	0.002	1
132	1	18	DA	H2''	H	2.349	0.002	1
133	1	18	DA	H3'	H	4.681	0.002	1
134	1	18	DA	H8	H	7.875	0.001	1
135	1	18	DA	C8	C	141.367		1
136	1	19	DC	H1'	H	5.691	0.006	1
137	1	19	DC	H2'	H	2.114	0.011	2
138	1	19	DC	H2''	H	2.365	0.004	2
139	1	19	DC	H3'	H	4.584	0.006	1
140	1	19	DC	H5	H	5.786	0.004	1
141	1	19	DC	H6	H	7.300	0.001	1
142	1	19	DC	C6	C	142.870		1
143	1	20	G	H1	H	11.604	0.001	1
144	1	20	G	H1'	H	5.611	0.004	1
145	1	20	G	H2'	H	4.922	0.0	1
146	1	20	G	H8	H	8.173	0.001	1
147	1	20	G	C8	C	138.882		1
148	1	21	DG	H1	H	11.523	0.002	1
149	1	21	DG	H1'	H	6.038	0.001	1
150	1	21	DG	H2'	H	2.521	0.004	1
151	1	21	DG	H2''	H	2.675	0.002	1
152	1	21	DG	H3'	H	4.986	0.001	1
153	1	21	DG	H4'	H	4.450	0.001	1
154	1	21	DG	H8	H	7.938	0.001	1
155	1	21	DG	C8	C	138.326		1
156	1	22	DG	H1	H	11.519	0.005	1
157	1	22	DG	H1'	H	6.334	0.002	1
158	1	22	DG	H2'	H	2.603	0.003	1
159	1	22	DG	H2''	H	2.454	0.0	1
160	1	22	DG	H3'	H	4.687	0.001	1
161	1	22	DG	H4'	H	4.353	0.002	1
162	1	22	DG	H8	H	7.906	0.001	1
163	1	22	DG	C8	C	137.873		1

Release date

2018-01-16

Citation

DNA-RNA Hybrid Quadruplexes Reveal Interactions that Favor RNA Parallel Topologies
Haase, L., Dickerhoff, J., Weisz, K.
Chemistry (2018), 24, 15365-15371, PubMed 30084512 , DOI 10.1002/chem.201803367 , Abstract

Experiments performed 9 experiments Detail

1 2D 1H-1H NOESY mixing time 500 ms

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7, Details 10 mM potassium phosphate, 0.48 mM DNA/RNA (5'-R(*G)-D(P*GP*GP*AP*TP*GP*GP*GP*AP*CP*AP*CP*AP*GP*GP*GP*GP*AP*C)-R(P*G)-D(P*GP*G)-3'), 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
1	potassium phosphate	natural abundance		10 mM
2	entity_1	natural abundance		0.48 mM

2 2D 1H-1H NOESY mixing time 300 ms

Instrument

Bruker Avance - 600 MHz

Sample

#	Name	Isotope labeling	Type	Concentration
1	potassium phosphate	natural abundance		10 mM
2	entity_1	natural abundance		0.48 mM

3 2D 1H-1H NOESY mixing time 150 ms

Instrument

Bruker Avance - 600 MHz

Sample

#	Name	Isotope labeling	Type	Concentration
1	potassium phosphate	natural abundance		10 mM
2	entity_1	natural abundance		0.48 mM

4 2D 1H-1H NOESY mixing time 80 ms

Instrument

Bruker Avance - 600 MHz

Sample

#	Name	Isotope labeling	Type	Concentration
1	potassium phosphate	natural abundance		10 mM
2	entity_1	natural abundance		0.48 mM

5 2D 1H-13C HSQC aromatic

Instrument

Bruker Avance - 600 MHz

Sample

#	Name	Isotope labeling	Type	Concentration
1	potassium phosphate	natural abundance		10 mM
2	entity_1	natural abundance		0.48 mM

6 2D 1H-1H NOESY mixing time 300 ms

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7, Details 10 mM potassium phosphate, 0.48 mM DNA/RNA (5'-R(*G)-D(P*GP*GP*AP*TP*GP*GP*GP*AP*CP*AP*CP*AP*GP*GP*GP*GP*AP*C)-R(P*G)-D(P*GP*G)-3'), 100% D2O

#	Name	Isotope labeling	Type	Concentration
3	potassium phosphate	natural abundance		10 mM
4	entity_1	natural abundance		0.48 mM

7 2D 1H-13C HSQC aromatic

Instrument

Bruker Avance - 600 MHz

Sample

#	Name	Isotope labeling	Type	Concentration
3	potassium phosphate	natural abundance		10 mM
4	entity_1	natural abundance		0.48 mM

8 2D DQF-COSY

Instrument

Bruker Avance - 600 MHz

Sample

#	Name	Isotope labeling	Type	Concentration
3	potassium phosphate	natural abundance		10 mM
4	entity_1	natural abundance		0.48 mM

9 2D 1H-1H TOCSY

Instrument

Bruker Avance - 600 MHz

Sample

#	Name	Isotope labeling	Type	Concentration
3	potassium phosphate	natural abundance		10 mM
4	entity_1	natural abundance		0.48 mM

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_34228_6ffr.nef
Input source #2: Coordindates	6ffr.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--
GGGATGGGACACAGGGGACGGG
||||||||||||||||||||||
GGGATGGGACACAGGGGACGGG

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	22	0	0	100.0

Content subtype: combined_34228_6ffr.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	161		100.0 (chain: A, length: 22)
1	Distance restraints	CNS/XPLOR_distance_constraints_6	OK	269 (1)	noe	100.0 (chain: A, length: 22)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	48 (1)	hbond	54.5 (chain: A, length: 22)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_5	OK	22 (22)	.	100.0 (chain: A, length: 22)

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: Warning
Sequence coverage of experimental data
- Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
Total number of assignments
- ¹H chemical shifts: 140
- ¹³C chemical shifts: 21

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
2	DG	C8	137.978
3	DG	C8	137.49
4	DA	C8	142.641
5	DT	C6	140.198
6	DG	C8	138.326
7	DG	C8	137.49
8	DG	C8	136.725
9	DA	C8	141.729
10	DC	C6	143.441
11	DA	C8	141.646
12	DC	C6	143.928
13	DA	C8	141.367
14	DG	C8	141.318
15	DG	C8	140.692
16	DG	C8	141.388
18	DA	C8	141.367
19	DC	C6	142.87
21	DG	C8	138.326
22	DG	C8	137.873

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	203	140	69.0
¹³C chemical shifts	12	2	16.7

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	152	97	63.8
¹³C chemical shifts	10	0	0.0

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	51	43	84.3
¹³C chemical shifts	2	2	100.0

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	1	1	100.0
¹³C chemical shifts	1	0	0.0

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	23	23	100.0
¹³C chemical shifts	2	2	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_6
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
- Total number of restraints: 269
- Weight of restraints: 1.0 (269)
- Potential type of restraints: square-well-parabolic (269)
- Range of distance target values: 2.9, 6.0 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 54.5%
  - Total number of restraints: 48
  - Weight of restraints: 1.0 (48)
  - Potential type of restraints: square-well-parabolic (48)
  - Range of distance target values: 1.95, 2.95 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_5
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
- Total number of restraints: 22
- Total number of restraints per polymer type: 22
- Weight of restraints: 1.0 (22)
- Potential type of restraints: square-well-parabolic (22)
- Dihedral angle restraints per residue
  - Chain_ID: A

Keywords DNA-RNA hybrid, quadruplex

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.346 seconds)

BMRB: 34228

Experiments performed 9 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 5 contents Detail