BMRBj - BMREntryMaster

Found 1 Document (0.386 seconds)

BMRB: 34302

6H1K

The major G-quadruplex form of HIV-1 LTR

Authors

Phan, A.T., Heddi, B., Butovskaya, E., Bakalar, B., Richter, S.N.

Assembly

DNA (28-MER)

Entity

1. DNA (28-MER) (polymer, Thiol state: not present), 28 monomers, 8928.618 Da Detail

GGGAGGCGTG GCCTGGGCGG GACTGGGG

Formula weight

8928.618 Da

Source organism

Human immunodeficiency virus 1

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 84.2 %, Completeness (bb): 87.2 % Detail

Polymer type: polydeoxyribonucleotide

	Total	¹H
All	84.2 % (223 of 265)	84.2 % (223 of 265)
Suger, PO4	87.2 % (171 of 196)	87.2 % (171 of 196)
Nucleobase	75.4 % (52 of 69)	75.4 % (52 of 69)
Aromatic	87.5 % (49 of 56)	87.5 % (49 of 56)
Methyl	100.0 % (3 of 3)	100.0 % (3 of 3)

1. entity 1

GGGAGGCGTG GCCTGGGCGG GACTGGGG

Show sample condition

Sample

Solvent system 90% H2O/10% D2O, Pressure 1 Pa, Temperature 298 K, pH 7.0, Details 70 mM NA potassium chloride, 20 mM NA potassium phosphate, 1 mM DNA (28-MER), 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
1	potassium chloride	natural abundance	70 mM
2	potassium phosphate	natural abundance	20 mM
3	DNA (28-MER)	natural abundance	1 mM

Release date

2018-07-12

Citation

Major G-Quadruplex Form of HIV-1 LTR Reveals a (3 + 1) Folding Topology Containing a Stem-Loop
Butovskaya, E., Heddi, B., Bakalar, B., Richter, S.N., Phan, A.T.
J. Am. Chem. Soc. (2018), 140, 13654-13662, PubMed 30299955 , DOI 10.1021/jacs.8b05332 , Abstract

Experiments performed 5 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker AvanceII - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 Pa, Temperature 298 K, pH 7.0, Details 70 mM NA potassium chloride, 20 mM NA potassium phosphate, 1 mM DNA (28-MER), 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
1	potassium chloride	natural abundance	70 mM
2	potassium phosphate	natural abundance	20 mM
3	DNA (28-MER)	natural abundance	1 mM

2 2D 1H-1H TOCSY

Instrument

Bruker AvanceII - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
1	potassium chloride	natural abundance	70 mM
2	potassium phosphate	natural abundance	20 mM
3	DNA (28-MER)	natural abundance	1 mM

3 2D 1H-13C HSQC

Instrument

Bruker AvanceII - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
1	potassium chloride	natural abundance	70 mM
2	potassium phosphate	natural abundance	20 mM
3	DNA (28-MER)	natural abundance	1 mM

4 2D 1H-13C HMBC

Instrument

Bruker AvanceII - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
1	potassium chloride	natural abundance	70 mM
2	potassium phosphate	natural abundance	20 mM
3	DNA (28-MER)	natural abundance	1 mM

5 2D 1H-13C HSQC aromatic

Instrument

Bruker AvanceII - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
1	potassium chloride	natural abundance	70 mM
2	potassium phosphate	natural abundance	20 mM
3	DNA (28-MER)	natural abundance	1 mM

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_34302_6h1k.nef
Input source #2: Coordindates	6h1k.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------
GGGAGGCGTGGCCTGGGCGGGACTGGGG
||||||||||||||||||||||||||||
GGGAGGCGTGGCCTGGGCGGGACTGGGG

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	28	0	0	100.0

Content subtype: combined_34302_6h1k.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	223		100.0 (chain: A, length: 28)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	433 (1)	noe	100.0 (chain: A, length: 28)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	66 (1)	hbond	64.3 (chain: A, length: 28)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_5	OK	35 (35)	.	60.7 (chain: A, length: 28)

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 28, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 223
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	265	223	84.2

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	196	171	87.2

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	69	52	75.4

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	3	3	100.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	22	22	100.0

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 28, Sequence coverage: 100.0%
- Total number of restraints: 430
- Weight of restraints: 1.0 (430)
- Potential type of restraints: square-well-parabolic (430)
- Range of distance target values: 2.4, 7.3 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 28, Sequence coverage: 64.3%
  - Total number of restraints: 66
  - Weight of restraints: 1.0 (66)
  - Potential type of restraints: square-well-parabolic (66)
  - Range of distance target values: 2.0, 2.9 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_5
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 28, Sequence coverage: 60.7%
- Total number of restraints: 35
- Total number of restraints per polymer type: 35
- Weight of restraints: 1.0 (35)
- Potential type of restraints: square-well-parabolic (35)
- Dihedral angle restraints per residue
  - Chain_ID: A

Keywords DNA, G-quadruplex structure, HIV-1 LTR, stem loop

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.386 seconds)

BMRB: 34302

Sample

Experiments performed 5 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 5 contents Detail