NMR solution structure of the C/D box snoRNA U14
Polymer type: polyribonucleotide
Total | 1H | 13C | 15N | 31P | |
---|---|---|---|---|---|
All | 87.6 % (461 of 526) | 89.3 % (242 of 271) | 93.7 % (192 of 205) | 84.2 % (16 of 19) | 35.5 % (11 of 31) |
Suger, PO4 | 85.2 % (317 of 372) | 88.2 % (164 of 186) | 91.6 % (142 of 155) | 35.5 % (11 of 31) | |
Nucleobase | 93.5 % (144 of 154) | 91.8 % (78 of 85) | 100.0 % (50 of 50) | 84.2 % (16 of 19) | |
Aromatic | 94.2 % (130 of 138) | 92.8 % (64 of 69) | 100.0 % (50 of 50) | 84.2 % (16 of 19) |
1. entity 1
GGCACGGUGA UGACCUUCGG GUCUGAGUGC CSolvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 90% H2O/10% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
2 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
3 | NaCl | natural abundance | 150 mM |
Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 90% H2O/10% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
2 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
3 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 288 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 90% H2O/10% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
2 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
3 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 90% H2O/10% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
2 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
3 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 90% H2O/10% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
2 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
3 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 288 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 90% H2O/10% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
2 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
3 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 90% H2O/10% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
2 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
3 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 90% H2O/10% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
2 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
3 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State anisotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 90% H2O/10% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
2 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
3 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 90% H2O/10% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
2 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
3 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 288 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 90% H2O/10% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
2 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
3 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 90% H2O/10% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
2 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
3 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State anisotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker AVANCE NEO - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker AVANCE NEO - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Bruker AVANCE NEO - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 500 uM RNA (31-MER), 500 uM [U-99% 13C; U-99% 15N] RNA (31-MER), 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (31-MER)_unlabel | natural abundance | 500 uM | |
5 | RNA (31-MER)_label | [U-99% 13C; U-99% 15N] | 500 uM | |
6 | NaCl | natural abundance | 150 mM |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints | combined_34321_6hyk.nef |
Input source #2: Coordindates | 6hyk.cif |
Diamagnetism of the molecular assembly | True (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | None |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Warning |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
NoneNon-standard residues
NoneSequence alignments
--------10--------20--------30- GGCACGGUGAUGACCUUCGGGUCUGAGUGCC ||||||||||||||||||||||||||||||| GGCACGGUGAUGACCUUCGGGUCUGAGUGCC
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
A | A | 31 | 0 | 0 | 100.0 |
Content subtype: combined_34321_6hyk.nef
Assigned chemical shifts
Comp_index_ID | Comp_ID | Atom_ID | CS value (ppm) |
---|---|---|---|
1 | G | N7 | 230.96 |
1 | G | N9 | 170.07 |
2 | G | N7 | 233.76 |
2 | G | N9 | 169.84 |
3 | C | C4 | 168.39 |
3 | C | N1 | 153.23 |
3 | C | N3 | 198.8 |
4 | A | N1 | 221.98 |
4 | A | N3 | 212.57 |
4 | A | N7 | 230.43 |
4 | A | N9 | 171.05 |
5 | C | C4 | 167.62 |
5 | C | N1 | 152.72 |
5 | C | N3 | 196.74 |
6 | G | N7 | 235.29 |
6 | G | N9 | 171.82 |
7 | G | N7 | 234.3 |
7 | G | N9 | 165.02 |
7 | G | P | -3.49 |
8 | U | C4 | 168.54 |
8 | U | N1 | 146.23 |
8 | U | P | -4.21 |
9 | G | N7 | 238.18 |
9 | G | N9 | 167.5 |
9 | G | P | -4.97 |
10 | A | N1 | 224.06 |
10 | A | N3 | 213.83 |
10 | A | N7 | 231.58 |
10 | A | N9 | 170.36 |
10 | A | P | -4.56 |
11 | U | C4 | 167.86 |
11 | U | N1 | 147.79 |
12 | G | N7 | 234.47 |
12 | G | N9 | 169.84 |
13 | A | N1 | 223.46 |
13 | A | N3 | 212.01 |
13 | A | N7 | 229.43 |
13 | A | N9 | 170.45 |
14 | C | C4 | 168.02 |
14 | C | N1 | 153.74 |
14 | C | N3 | 199.29 |
15 | C | C4 | 168.43 |
15 | C | N1 | 154.05 |
15 | C | N3 | 197.14 |
16 | U | C4 | 167.73 |
16 | U | N1 | 149.6 |
16 | U | P | -4.44 |
17 | U | C4 | 168.76 |
17 | U | N1 | 146.51 |
17 | U | P | -3.49 |
18 | C | C4 | 167.98 |
18 | C | N1 | 153.32 |
18 | C | P | -5.03 |
19 | G | N7 | 231.73 |
19 | G | N9 | 171.15 |
19 | G | P | -4.95 |
20 | G | N7 | 233.24 |
20 | G | N9 | 170.48 |
21 | G | N7 | 233.47 |
21 | G | N9 | 169.32 |
22 | U | C4 | 169.03 |
22 | U | N1 | 149.6 |
23 | C | C4 | 168.11 |
23 | C | N1 | 154.04 |
23 | C | N3 | 198.07 |
24 | U | C4 | 166.24 |
24 | U | N1 | 147.84 |
24 | U | P | -3.99 |
25 | G | N7 | 237.99 |
25 | G | N9 | 167.65 |
25 | G | P | -4.82 |
26 | A | N1 | 220.69 |
26 | A | N3 | 214.59 |
26 | A | N7 | 236.0 |
26 | A | N9 | 167.52 |
27 | G | N7 | 233.28 |
27 | G | N9 | 170.07 |
27 | G | P | -4.62 |
28 | U | C4 | 169.11 |
28 | U | N1 | 149.09 |
29 | G | N7 | 234.52 |
29 | G | N9 | 170.45 |
30 | C | C4 | 167.98 |
30 | C | N1 | 153.69 |
30 | C | N3 | 198.73 |
31 | C | C4 | 167.74 |
31 | C | N1 | 155.97 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 271 | 242 | 89.3 |
13C chemical shifts | 205 | 192 | 93.7 |
15N chemical shifts | 19 | 16 | 84.2 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 186 | 164 | 88.2 |
13C chemical shifts | 155 | 142 | 91.6 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 85 | 78 | 91.8 |
13C chemical shifts | 50 | 50 | 100.0 |
15N chemical shifts | 19 | 16 | 84.2 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 20 | 20 | 100.0 |
13C chemical shifts | 20 | 20 | 100.0 |
Distance restraints
--------10--------20--------30- GGCACGGUGAUGACCUUCGGGUCUGAGUGCC ||||| |||||||| ||||||||||||| GGCAC...GAUGACCU..GGGUCUGAGUGCC
Dihedral angle restraints
--------10--------20--------30- GGCACGGUGAUGACCUUCGGGUCUGAGUGCC ||||||||||||||||||||||||||||||| GGCACGGUGAUGACCUUCGGGUCUGAGUGCC
RDC restraints
--------10--------20--------30- GGCACGGUGAUGACCUUCGGGUCUGAGUGCC | |||||||||| ||||||| |||||| .G.ACGGUGAUGA..UUCGGGU.UGAGUG --------10--------20---------