Properties

Disulfide bonds

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Non-standard residues

Content subtype: bmr34524_3.str

Assigned chemical shifts

1. Saveframe: assigned_chemical_shifts_1
   • Status: Warning
   • Sequence coverage of experimental data
     • Entity_assembly_ID: 1, Chain length: 36, Sequence coverage: 100.0%

     --------10--------20--------30------
     TGAGGGTGGGTAGGGTGGGCTAGTCATTTTGACTAG
     ||||||||||||||||||||||||||||||||||||
     TGAGGGTGGGTAGGGTGGGCTAGTCATTTTGACTAG
     

   • Total number of assignments
     • ¹H chemical shifts: 251
     • ¹³C chemical shifts: 34
   • Completeness of assignments
     • Entity_assemble_ID: 1
       • Excluded Atom_ID in statistics

         Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
         1	DT	C6	139.489
         2	DG	C8	139.153
         3	DA	C8	141.461
         5	DG	C8	137.596
         6	DG	C8	137.504
         7	DT	C6	139.89
         9	DG	C8	138.145
         10	DG	C8	138.299
         11	DT	C6	140.11
         12	DA	C8	143.18
         13	DG	C8	138.423
         14	DG	C8	137.863
         15	DG	C8	138.289
         16	DT	C6	139.884
         17	DG	C8	137.825
         18	DG	C8	138.236
         19	DG	C8	138.221
         20	DC	C6	142.882
         21	DT	C6	139.607
         22	DA	C8	141.895
         23	DG	C8	137.256
         24	DT	C6	138.494
         25	DC	C6	143.556
         26	DA	C8	142.034
         27	DT	C6	139.338
         28	DT	C6	139.465
         29	DT	C6	139.562
         30	DT	C6	139.557
         31	DG	C8	138.369
         32	DA	C8	141.151
         33	DC	C6	141.906
         34	DT	C6	139.623
         35	DA	C8	141.768
         36	DG	C8	136.907

       • All atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	341	229	67.2

       • Backbone atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	252	151	59.9

       • Side chain atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	89	78	87.6

       • Methyl group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	11	11	100.0
         13C chemical shifts	11	0	0.0

       • Aromatic group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	28	27	96.4

   • Histogram of normalized assigned chemical shifts