BMRBj - BMREntryMaster

Found 1 Document (0.323 seconds)

BMRB: 34543

Antiparallel basket-type G-quadruplex DNA structure formed in human Bcl-2 promoter

Authors

Bielskute, S., Plavec, J., Podbevsek, P.

Assembly

bcl2ex

Entity

1. bcl2ex (polymer, Thiol state: not present), 25 monomers, 8024.066 Da Detail

CGGGCGCGGG AGGAAGGGGG CGGGA

Formula weight

8024.066 Da

Source organism

Homo sapiens

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 60.1 %, Completeness (bb): 52.0 % Detail

Polymer type: polydeoxyribonucleotide

	Total	¹H
All	60.1 % (140 of 233)	60.1 % (140 of 233)
Suger, PO4	52.0 % (91 of 175)	52.0 % (91 of 175)
Nucleobase	84.5 % (49 of 58)	84.5 % (49 of 58)
Aromatic	90.0 % (45 of 50)	90.0 % (45 of 50)

1. entity 1

CGGGCGCGGG AGGAAGGGGG CGGGA

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 101325 Pa, Temperature 298 K, pH 7, Details 0.7 mM NA bcl2ex, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
1	bcl2ex	natural abundance		0.7 mM

Sample #2

Solvent system 100% D2O, Pressure 101325 Pa, Temperature 298 K, pH 7, Details 0.7 mM NA bcl2ex, 100% D2O

#	Name	Isotope labeling	Type	Concentration
2	bcl2ex	natural abundance		0.7 mM

Release date

2020-08-23

Citation

Oxidative lesions modulate G-quadruplex stability and structure in the human BCL2 promoter
Bielskute, S., Plavec, J., Podbevsek, P.
Nucleic Acids Res. (2021), 49, 2346-2356, PubMed 33638996 , DOI 10.1093/nar/gkab057 , Abstract

Experiments performed 3 experiments Detail

Chemical shift validation 3 contents Detail

Properties

Input source #1: Assigned chemical shifts - Assigned chemical shifts	bmr34543_3.str
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Content subtype: bmr34543_3.str

#	Content subtype	Saveframe	Status	# of rows	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	166		100.0 (chain: 1, length: 25)
1	Chemical shift references	chem_shift_reference_1	OK	1		No information

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: 1, Chain length: 25, Sequence coverage: 100.0%

--------10--------20-----
CGGGCGCGGGAGGAAGGGGGCGGGA
|||||||||||||||||||||||||
CGGGCGCGGGAGGAAGGGGGCGGGA

Total number of assignments
- ¹H chemical shifts: 140
- ¹³C chemical shifts: 26

Completeness of assignments

Entity_assemble_ID: 1

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	DC	C6	147.5
2	DG	C8	137.49
3	DG	C8	141.08
4	DG	C8	137.85
5	DC	C6	144.3
6	DG	C8	137.92
7	DC	C6	142.91
8	DG	C8	141.76
9	DG	C8	138.43
10	DG	C8	140.21
11	DA	C2	155.38
11	DA	C8	140.12
12	DG	C8	138.36
13	DG	C8	138.74
14	DA	C8	140.43
15	DA	C8	141.59
16	DG	C8	138.96
17	DG	C8	136.99
18	DG	C8	140.52
19	DG	C8	137.83
20	DG	C8	139.85
21	DC	C6	141.34
22	DG	C8	142.14
23	DG	C8	137.99
24	DG	C8	140.42
25	DA	C8	142.11

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	233	140	60.1

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	175	91	52.0

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	58	49	84.5

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	25	23	92.0

Histogram of normalized assigned chemical shifts

Keywords DNA, G-quadruplex, bcl2, promoter

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.323 seconds)

BMRB: 34543

Sample #1

Sample #2

Experiments performed 3 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Chemical shift validation 3 contents Detail