BMRBj - BMREntryMaster

Found 1 Document (0.246 seconds)

BMRB: 34615

Hybrid-2R quadruplex-duplex with (-p-p-l) topology and 3 syn residues

Authors

Mohr, S., Vianney, Y.M., Weisz, K.

Assembly

DNA (31-MER)

Entity

1. DNA (31-MER) (polymer, Thiol state: not present), 31 monomers, 9936.050 Da Detail

XGAGGGTGGG TGGGACGCGC AGCGTXGXTA A

Formula weight

9936.05 Da

Source organism

synthetic construct

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 83.9 %, Completeness: 59.1 %, Completeness (bb): 52.6 % Detail

Polymer type: polydeoxyribonucleotide

	Total	¹H
All	59.1 % (156 of 264)	59.1 % (156 of 264)
Suger, PO4	52.6 % (103 of 196)	52.6 % (103 of 196)
Nucleobase	77.9 % (53 of 68)	77.9 % (53 of 68)
Aromatic	80.4 % (45 of 56)	80.4 % (45 of 56)
Methyl	50.0 % (2 of 4)	50.0 % (2 of 4)

1. entity 1

XGAGGGTGGG TGGGACGCGC AGCGTXGXTA A

Show sample condition

Sample

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 303 K, pH 7.0, Details 0.3 mM no DNA (31-MER), 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
1	DNA (31-MER)	natural abundance		0.3 mM
2	potassium phosphate buffer	natural abundance		10 mM

Release date

2021-04-04

Citation

Expanding the Topological Landscape by a G-Column Flip of a Parallel G-Quadruplex
Mohr, S., Jana, J., Vianney, Y.M., Weisz, K.
Chemistry (2021), 27, 10437-10447, PubMed 33955615 , DOI 10.1002/chem.202101181 , Abstract

Experiments performed 2 experiments Detail

Chemical shift validation 3 contents Detail

Properties

Input source #1: Assigned chemical shifts - Assigned chemical shifts	bmr34615_3.str
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
1	1	THM	THYMIDINE	Assigned chemical shifts
1	26	BGM	8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE	Assigned chemical shifts
1	28	BGM	8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE	Assigned chemical shifts

Content subtype: bmr34615_3.str

#	Content subtype	Saveframe	Status	# of rows	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	203		93.5 (chain: 1, length: 31)
1	Chemical shift references	chem_shift_reference_1	Warning	2		No information

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: 1, Chain length: 31, Sequence coverage: 93.5%

--------10--------20--------30-
XGAGGGTGGGTGGGACGCGCAGCGTXGXTAA
|||||| ||| ||||||||||||||||||||
XGAGGG.GGG.GGGACGCGCAGCGTXGXTAA

Total number of assignments
- ¹H chemical shifts: 177
- ¹³C chemical shifts: 26

Completeness of assignments

Entity_assemble_ID: 1

Excluded Comp_ID in statistics

Comp_index_ID	Comp_ID
1	THM
26	BGM
28	BGM

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
2	DG	C8	139.073
3	DA	C2	154.914
3	DA	C8	141.466
4	DG	C8	137.684
5	DG	C8	137.2
6	DG	C8	138.918
8	DG	C8	137.497
9	DG	C8	138.028
10	DG	C8	138.109
12	DG	C8	137.341
15	DA	C2	155.06
15	DA	C8	141.247
16	DC	C6	142.512
17	DG	C8	138.178
18	DC	C6	141.646
19	DG	C8	139.14
20	DC	C6	143.517
23	DC	C6	142.751
24	DG	C8	138.453
25	DT	C6	137.923
27	DG	C8	140.253
29	DT	C6	139.78
30	DA	C2	154.462
30	DA	C8	141.63
31	DA	C8	141.059

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	264	156	59.1

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	196	103	52.6

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	68	53	77.9

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	4	2	50.0
¹³C chemical shifts	4	0	0.0

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	25	22	88.0

Histogram of normalized assigned chemical shifts

Keywords DNA, Hybrid topology, Quadruplex-Duplex Hybrid

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.246 seconds)

BMRB: 34615

Sample

Experiments performed 2 experiments Detail

Instrument

Sample

Instrument

Sample

Chemical shift validation 3 contents Detail