BMRBj - BMREntryMaster

Found 1 Document (0.366 seconds)

BMRB: 34654

7PDU

Pre-catalytic complex of 10-23 DNAzyme with RNA target

Authors

Etzkorn, M., Borggrafe, J., Viegas, A.

Assembly

10-23 DNAzyme (33-MER), RNA target (19-MER)

Entity

1. 10-23 DNAzyme (33-MER), RNA target (19-MER), entity 1 (polymer, Thiol state: not present), 33 monomers, 10329.56 Da Detail

TTGGGGTAAG GCTCGCTACA ACGAGGTGCA TGT

2. 10-23 DNAzyme (33-MER), RNA target (19-MER), entity 2 (polymer, Thiol state: not present), 19 monomers, 6043.612 Da Detail

ACAUGCACCG UUACCCCAA

Total weight

16373.172 Da

Max. entity weight

10329.56 Da

Source organism

synthetic construct

Exptl. method

solution NMR

Data set

assigned_chemical_shifts, spectral_peak_list

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 65.4 %, Completeness (bb): 68.4 % Detail

Polymer type: polydeoxyribonucleotide polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	65.4 % (408 of 624)	83.4 % (407 of 488)	0.0 % (0 of 131)	20.0 % (1 of 5)
Suger, PO4	68.4 % (301 of 440)	87.2 % (301 of 345)	0.0 % (0 of 95)
Nucleobase	58.2 % (107 of 184)	74.1 % (106 of 143)	0.0 % (0 of 36)	20.0 % (1 of 5)
Aromatic	56.1 % (83 of 148)	76.6 % (82 of 107)	0.0 % (0 of 36)	20.0 % (1 of 5)
Methyl	100.0 % (8 of 8)	100.0 % (8 of 8)

1. entity 1

TTGGGGTAAG GCTCGCTACA ACGAGGTGCA TGT

2. entity 2

ACAUGCACCG UUACCCCAA

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 310.12 K, pH 7.5, Details 500 uM 110-23 DNAzyme (33-MER), 500 uM RNA target (19-MER), 50 mM n.a. Tris-d11, 100 mM n.a. NaCl, 1 mM n.a. MgCl2, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
1	110-23 DNAzyme (33-MER)	natural abundance	500 uM
2	RNA target (19-MER)	natural abundance	500 uM
3	Tris-d11	natural abundance	50 mM
4	NaCl	natural abundance	100 mM
5	MgCl2	natural abundance	1 mM

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 310.12 K, pH 7.5, Details 750 uM 110-23 DNAzyme (33-MER), 750 uM RNA target (19-MER), 50 mM n.a. Tris-d11, 100 mM n.a. NaCl, 1 mM n.a. MgCl2, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
6	110-23 DNAzyme (33-MER)	natural abundance	750 uM
7	RNA target (19-MER)	natural abundance	750 uM
8	Tris-d11	natural abundance	50 mM
9	NaCl	natural abundance	100 mM
10	MgCl2	natural abundance	1 mM

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 310.12 K, pH 7.5, Details 500 uM [U-13C; U-15N] 110-23 DNAzyme (33-MER), 500 uM RNA target (19-MER), 50 mM n.a. Tris-d11, 100 mM n.a. NaCl, 1 mM n.a. MgCl2, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
11	110-23 DNAzyme (33-MER)	[U-13C; U-15N]	500 uM
12	RNA target (19-MER)	natural abundance	500 uM
13	Tris-d11	natural abundance	50 mM
14	NaCl	natural abundance	100 mM
15	MgCl2	natural abundance	1 mM

Release date

2021-08-30

Citation

Time-resolved structural analysis of an RNA-cleaving DNA catalyst
Borggrafe, J., Victor, J., Rosenbach, H., Viegas, A., Gertzen, C., Wuebben, C., Kovacs, H., Gopalswamy, M., Riesner, D., Steger, G., Schiemann, O., Gohlke, H., Span, I., Etzkorn, M.
Nature (2022), 601, 144-149, PubMed 34949858 , DOI 10.1038/s41586-021-04225-4 , Abstract

Related entities 2. 10-23 DNAzyme (33-MER), RNA target (19-MER), entity 2, : 1 entities Detail

Experiments performed 7 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker AVANCE III HD - 900 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 310.12 K, pH 7.5, Details 500 uM 110-23 DNAzyme (33-MER), 500 uM RNA target (19-MER), 50 mM n.a. Tris-d11, 100 mM n.a. NaCl, 1 mM n.a. MgCl2, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
1	110-23 DNAzyme (33-MER)	natural abundance	500 uM
2	RNA target (19-MER)	natural abundance	500 uM
3	Tris-d11	natural abundance	50 mM
4	NaCl	natural abundance	100 mM
5	MgCl2	natural abundance	1 mM

2 2D 1H-1H TOCSY

Instrument

Bruker AVANCE III HD - 900 MHz

Sample

#	Name	Isotope labeling	Concentration
1	110-23 DNAzyme (33-MER)	natural abundance	500 uM
2	RNA target (19-MER)	natural abundance	500 uM
3	Tris-d11	natural abundance	50 mM
4	NaCl	natural abundance	100 mM
5	MgCl2	natural abundance	1 mM

3 2D 1H-13C HSQC aliphatic

Instrument

Bruker AVANCE III HD - 750 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 310.12 K, pH 7.5, Details 500 uM [U-13C; U-15N] 110-23 DNAzyme (33-MER), 500 uM RNA target (19-MER), 50 mM n.a. Tris-d11, 100 mM n.a. NaCl, 1 mM n.a. MgCl2, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
11	110-23 DNAzyme (33-MER)	[U-13C; U-15N]	500 uM
12	RNA target (19-MER)	natural abundance	500 uM
13	Tris-d11	natural abundance	50 mM
14	NaCl	natural abundance	100 mM
15	MgCl2	natural abundance	1 mM

4 2D 1H-13C HSQC-TOCSY

Instrument

Bruker AVANCE III HD - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
11	110-23 DNAzyme (33-MER)	[U-13C; U-15N]	500 uM
12	RNA target (19-MER)	natural abundance	500 uM
13	Tris-d11	natural abundance	50 mM
14	NaCl	natural abundance	100 mM
15	MgCl2	natural abundance	1 mM

5 3D 1H-13C NOESY aliphatic

Instrument

Bruker AVANCE III HD - 750 MHz

Sample

#	Name	Isotope labeling	Concentration
11	110-23 DNAzyme (33-MER)	[U-13C; U-15N]	500 uM
12	RNA target (19-MER)	natural abundance	500 uM
13	Tris-d11	natural abundance	50 mM
14	NaCl	natural abundance	100 mM
15	MgCl2	natural abundance	1 mM

6 2D 1H-1H NOESY

Instrument

Bruker AVANCE III HD - 600 MHz

Sample

State anisotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 310.12 K, pH 7.5, Details 750 uM 110-23 DNAzyme (33-MER), 750 uM RNA target (19-MER), 50 mM n.a. Tris-d11, 100 mM n.a. NaCl, 1 mM n.a. MgCl2, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
6	110-23 DNAzyme (33-MER)	natural abundance	750 uM
7	RNA target (19-MER)	natural abundance	750 uM
8	Tris-d11	natural abundance	50 mM
9	NaCl	natural abundance	100 mM
10	MgCl2	natural abundance	1 mM

7 2D 1H-1H TOCSY

Instrument

Bruker AVANCE III HD - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 310.12 K, pH 7.5, Details 750 uM 110-23 DNAzyme (33-MER), 750 uM RNA target (19-MER), 50 mM n.a. Tris-d11, 100 mM n.a. NaCl, 1 mM n.a. MgCl2, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
6	110-23 DNAzyme (33-MER)	natural abundance	750 uM
7	RNA target (19-MER)	natural abundance	750 uM
8	Tris-d11	natural abundance	50 mM
9	NaCl	natural abundance	100 mM
10	MgCl2	natural abundance	1 mM

Chemical shift validation 4 contents Detail

Properties

Input source #1: Assigned chemical shifts - Assigned chemical shifts	bmr34654_3.str
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Content subtype: bmr34654_3.str

#	Content subtype	Saveframe	Status	# of rows	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	547		100.0 (chain: 2, length: 19), 100.0 (chain: 1, length: 33)
1	Chemical shift references	chem_shift_reference_1	OK	1		No information

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: 2, Chain length: 19, Sequence coverage: 100.0%

--------10---------
ACAUGCACCGUUACCCCAA
|||||||||||||||||||
ACAUGCACCGUUACCCCAA

Entity_assembly_ID: 1, Chain length: 33, Sequence coverage: 100.0%

--------10--------20--------30---
TTGGGGTAAGGCTCGCTACAACGAGGTGCATGT
|||||||||||||||||||||||||||||||||
TTGGGGTAAGGCTCGCTACAACGAGGTGCATGT

Total number of assignments
- ¹H chemical shifts: 423
- ¹³C chemical shifts: 118
- ¹⁵N chemical shifts: 6

Completeness of assignments

Entity_assemble_ID: 2

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
6	C	N4	97.369
14	C	N4	97.522
17	C	N4	97.593

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	171	145	84.8
¹³C chemical shifts	131	0	0.0
¹⁵N chemical shifts	5	1	20.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	114	95	83.3
¹³C chemical shifts	95	0	0.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	57	50	87.7
¹³C chemical shifts	36	0	0.0
¹⁵N chemical shifts	5	1	20.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	14	13	92.9
¹³C chemical shifts	14	0	0.0

Entity_assemble_ID: 1

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	DT	C1'	88.547
1	DT	C2'	40.301
1	DT	C3'	77.766
1	DT	C4'	88.496
1	DT	C5'	63.774
1	DT	C7	14.217
2	DT	C1'	86.763
2	DT	C2'	39.942
2	DT	C3'	78.654
2	DT	C7	14.344
3	DG	C1'	84.944
3	DG	C2'	41.594
3	DG	C3'	76.817
3	DG	C4'	86.364
4	DG	C1'	85.532
4	DG	C2'	42.011
4	DG	C3'	78.577
4	DG	C4'	85.806
5	DG	C1'	85.96
5	DG	C2'	42.018
6	DG	C1'	86.519
6	DG	C2'	41.767
6	DG	C3'	75.934
7	DT	C1'	86.454
7	DT	C2'	40.765
7	DT	C3'	77.281
7	DT	C7	13.89
8	DA	C1'	85.505
8	DA	C2'	40.481
8	DA	C3'	78.661
9	DA	C1'	84.126
9	DA	C2'	41.504
9	DA	C3'	77.965
10	DG	C1'	85.407
10	DG	C2'	42.015
10	DG	C3'	78.359
11	DG	C1'	84.758
11	DG	C2'	40.285
11	DG	C3'	78.217
12	DC	C1'	87.812
12	DC	C2'	41.137
12	DC	C3'	79.092
13	DT	C1'	87.163
13	DT	C2'	39.817
13	DT	C3'	79.58
13	DT	C7	14.335
14	DC	C1'	87.29
14	DC	C2'	39.663
14	DC	C3'	77.967
15	DG	C1'	84.966
15	DG	C2'	40.521
15	DG	C3'	78.645
15	DG	C4'	87.815
16	DC	C1'	88.294
16	DC	C2'	40.985
16	DC	C3'	77.506
17	DT	C1'	87.252
17	DT	C2'	39.684
17	DT	C3'	75.376
17	DT	C4'	86.861
17	DT	C7	14.433
18	DA	C1'	85.942
18	DA	C2'	40.296
18	DA	C3'	78.526
19	DC	C1'	87.341
19	DC	C2'	40.278
19	DC	C3'	77.824
19	DC	C5'	67.449
20	DA	C1'	85.522
20	DA	C2'	39.238
20	DA	C3'	79.256
20	DA	C4'	87.652
21	DA	C1'	85.222
21	DA	C2'	40.222
21	DA	C3'	78.559
22	DC	C1'	87.087
22	DC	C2'	39.387
22	DC	C3'	77.43
23	DG	C1'	84.682
23	DG	C2'	39.676
23	DG	C3'	79.1
24	DA	C1'	85.239
24	DA	C2'	40.329
24	DA	C3'	78.433
24	DA	C4'	87.399
25	DG	C1'	85.103
25	DG	C2'	41.027
25	DG	C3'	77.489
25	DG	C4'	86.683
26	DG	C1'	85.881
26	DG	C2'	41.469
26	DG	C3'	75.027
27	DT	C1'	85.082
27	DT	C2'	40.621
27	DT	C3'	77.96
27	DT	C7	13.646
28	DG	C1'	85.503
28	DG	C2'	40.057
28	DG	C3'	77.337
28	DG	N1	147.386
29	DC	C1'	86.871
29	DC	C2'	41.016
29	DC	C3'	76.386
29	DC	N4	98.15
30	DA	C1'	85.973
30	DA	C2'	42.094
30	DA	C3'	77.131
31	DT	C1'	85.477
31	DT	C2'	40.289
31	DT	C3'	78.484
31	DT	C7	13.937
32	DG	C1'	85.214
32	DG	C2'	42.007
32	DG	C3'	78.551
32	DG	C5'	67.066
33	DT	C1'	86.528
33	DT	C2'	41.565
33	DT	C3'	72.358
33	DT	C4'	86.499
33	DT	C7	13.838

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	317	262	82.6

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	231	206	89.2

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	86	56	65.1

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	8	8	100.0
¹³C chemical shifts	8	8	100.0

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	26	25	96.2

Histogram of normalized assigned chemical shifts

Keywords 10-23 DNAzyme, DNA-RNA HYBRID, RNA-cleaving DNAzyme, pre-catalytic complex

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.366 seconds)

BMRB: 34654

Sample #1

Sample #2

Sample #3

Related entities 2. 10-23 DNAzyme (33-MER), RNA target (19-MER), entity 2, : 1 entities Detail

Experiments performed 7 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Chemical shift validation 4 contents Detail