BMRBj - BMREntryMaster

ID	Entity ID	Seq ID	Comp ID	Atom ID	Atom type	Val	Val err	Ambig. code
1	1	1	G	H1	H	12.921	0.020	1
2	1	2	G	H1	H	13.391	0.020	1
3	1	3	C	H41	H	6.844	0.020	1
4	1	4	G	H1	H	13.001	0.020	1
5	1	5	U	H1'	H	5.555	0.020	1
6	1	5	U	H2'	H	4.547	0.020	1
7	1	5	U	H3	H	14.547	0.020	1
8	1	5	U	H3'	H	4.272	0.020	1
9	1	5	U	H4'	H	4.479	0.020	1
10	1	5	U	H5	H	5.182	0.020	2
11	1	5	U	H5'	H	4.492	0.020	2
12	1	5	U	H5''	H	4.062	0.020	2
13	1	5	U	H6	H	7.508	0.020	1
14	1	5	U	C1'	C	93.430	0.3	1
15	1	5	U	C2	C	152.738	0.3	1
16	1	5	U	C2'	C	75.274	0.3	1
17	1	5	U	C3'	C	72.021	0.3	1
18	1	5	U	C4	C	168.905	0.3	1
19	1	5	U	C4'	C	81.876	0.3	1
20	1	5	U	C5	C	102.972	0.3	1
21	1	5	U	C5'	C	64.417	0.3	1
22	1	5	U	C6	C	140.780	0.3	1
23	1	5	U	N1	N	146.214	0.3	1
24	1	5	U	N3	N	162.995	0.3	1
25	1	5	U	P	P	-1.232	0.3	1
26	1	5	U	HO2'	H	7.151	0.020	1
27	1	6	U	H1'	H	5.290	0.020	1
28	1	6	U	H2'	H	4.173	0.020	1
29	1	6	U	H3	H	11.213	0.020	1
30	1	6	U	H3'	H	4.455	0.020	1
31	1	6	U	H4'	H	4.445	0.020	1
32	1	6	U	H5	H	5.710	0.020	2
33	1	6	U	H5'	H	4.494	0.020	2
34	1	6	U	H5''	H	4.067	0.020	2
35	1	6	U	H6	H	7.786	0.020	1
36	1	6	U	C1'	C	94.114	0.3	1
37	1	6	U	C2	C	154.042	0.3	1
38	1	6	U	C2'	C	75.263	0.3	1
39	1	6	U	C3'	C	71.707	0.3	1
40	1	6	U	C4	C	166.997	0.3	1
41	1	6	U	C4'	C	82.369	0.3	1
42	1	6	U	C5	C	104.561	0.3	1
43	1	6	U	C5'	C	64.235	0.3	1
44	1	6	U	C6	C	140.941	0.3	1
45	1	6	U	N1	N	146.031	0.3	1
46	1	6	U	N3	N	157.626	0.3	1
47	1	6	U	P	P	-1.156	0.3	1
48	1	6	U	HO2'	H	6.887	0.020	1
49	1	7	U	H1'	H	5.343	0.020	1
50	1	7	U	H2'	H	4.174	0.020	1
51	1	7	U	H3	H	11.478	0.020	1
52	1	7	U	H3'	H	4.478	0.020	1
53	1	7	U	H4'	H	4.399	0.020	1
54	1	7	U	H5	H	5.705	0.020	2
55	1	7	U	H5'	H	4.501	0.020	2
56	1	7	U	H5''	H	4.065	0.020	2
57	1	7	U	H6	H	7.963	0.020	1
58	1	7	U	C1'	C	93.546	0.3	1
59	1	7	U	C2	C	153.340	0.3	1
60	1	7	U	C2'	C	75.289	0.3	1
61	1	7	U	C3'	C	71.902	0.3	1
62	1	7	U	C4	C	168.093	0.3	1
63	1	7	U	C4'	C	82.023	0.3	1
64	1	7	U	C5	C	103.282	0.3	1
65	1	7	U	C5'	C	64.260	0.3	1
66	1	7	U	C6	C	142.905	0.3	1
67	1	7	U	N1	N	147.765	0.3	1
68	1	7	U	N3	N	157.494	0.3	1
69	1	7	U	P	P	-1.549	0.3	1
70	1	7	U	HO2'	H	7.214	0.020	1
71	1	8	U	H1'	H	5.601	0.020	1
72	1	8	U	H2'	H	4.366	0.020	1
73	1	8	U	H3	H	10.722	0.020	1
74	1	8	U	H3'	H	4.472	0.020	1
75	1	8	U	H4'	H	4.380	0.020	1
76	1	8	U	H5	H	5.651	0.020	2
77	1	8	U	H5'	H	4.509	0.020	2
78	1	8	U	H5''	H	4.082	0.020	2
79	1	8	U	H6	H	7.836	0.020	1
80	1	8	U	C1'	C	94.154	0.3	1
81	1	8	U	C2	C	152.496	0.3	1
82	1	8	U	C2'	C	74.739	0.3	1
83	1	8	U	C3'	C	71.915	0.3	1
84	1	8	U	C4	C	169.116	0.3	1
85	1	8	U	C4'	C	82.105	0.3	1
86	1	8	U	C5	C	102.867	0.3	1
87	1	8	U	C5'	C	64.155	0.3	1
88	1	8	U	C6	C	143.106	0.3	1
89	1	8	U	N1	N	148.810	0.3	1
90	1	8	U	N3	N	157.120	0.3	1
91	1	8	U	P	P	-1.193	0.3	1
92	1	8	U	HO2'	H	6.830	0.020	1
93	1	9	C	H5	H	5.926	0.020	1
94	1	9	C	H6	H	8.060	0.020	1
95	1	9	C	H41	H	7.365	0.020	1
96	1	9	C	H42	H	8.446	0.020	1
97	1	10	G	H1	H	12.769	0.020	1
98	1	11	C	H41	H	7.009	0.020	1
99	1	11	C	H42	H	8.616	0.020	1
100	1	12	U	H1'	H	5.662	0.020	1
101	1	12	U	H2'	H	3.794	0.020	1
102	1	12	U	H3	H	11.783	0.020	1
103	1	12	U	H3'	H	4.551	0.020	1
104	1	12	U	H4'	H	4.379	0.020	1
105	1	12	U	H5	H	5.766	0.020	2
106	1	12	U	H5'	H	4.490	0.020	2
107	1	12	U	H5''	H	4.086	0.020	2
108	1	12	U	H6	H	7.784	0.020	1
109	1	12	U	C1'	C	94.381	0.3	1
110	1	12	U	C2	C	153.021	0.3	1
111	1	12	U	C2'	C	75.819	0.3	1
112	1	12	U	C3'	C	72.933	0.3	1
113	1	12	U	C4	C	167.947	0.3	1
114	1	12	U	C4'	C	82.029	0.3	1
115	1	12	U	C5	C	104.774	0.3	1
116	1	12	U	C5'	C	63.831	0.3	1
117	1	12	U	C6	C	140.429	0.3	1
118	1	12	U	N1	N	146.867	0.3	1
119	1	12	U	N3	N	159.928	0.3	1
120	1	12	U	P	P	-1.266	0.3	1
121	1	12	U	HO2'	H	6.670	0.020	1
122	1	13	U	H1'	H	6.109	0.020	1
123	1	13	U	H2'	H	4.677	0.020	1
124	1	13	U	H3'	H	4.014	0.020	1
125	1	13	U	H4'	H	4.488	0.020	1
126	1	13	U	H5	H	5.865	0.020	2
127	1	13	U	H5'	H	4.254	0.020	2
128	1	13	U	H5''	H	4.045	0.020	2
129	1	13	U	H6	H	8.024	0.020	1
130	1	13	U	C1'	C	88.914	0.3	1
131	1	13	U	C2	C	154.934	0.3	1
132	1	13	U	C2'	C	74.487	0.3	1
133	1	13	U	C3'	C	77.580	0.3	1
134	1	13	U	C4	C	168.830	0.3	1
135	1	13	U	C4'	C	86.762	0.3	1
136	1	13	U	C5	C	105.279	0.3	1
137	1	13	U	C5'	C	67.662	0.3	1
138	1	13	U	C6	C	144.464	0.3	1
139	1	13	U	N1	N	143.752	0.3	1
140	1	13	U	N3	N	158.195	0.3	1
141	1	13	U	P	P	-0.528	0.3	1
142	1	13	U	HO2'	H	6.673	0.020	1
143	1	15	G	H1	H	9.909	0.020	1
144	1	16	G	H1	H	13.444	0.020	1
145	1	17	C	H41	H	6.801	0.020	1
146	1	17	C	H42	H	8.600	0.020	1
147	1	18	G	H1	H	13.130	0.020	1
148	1	18	G	H2'	H	4.664	0.020	1
149	1	18	G	H8	H	7.707	0.020	1
150	1	18	G	H21	H	5.966	0.020	1
151	1	18	G	H22	H	8.596	0.020	1
152	1	19	U	H1'	H	5.468	0.020	1
153	1	19	U	H2'	H	4.358	0.020	1
154	1	19	U	H3	H	11.406	0.020	1
155	1	19	U	H3'	H	4.407	0.020	1
156	1	19	U	H4'	H	4.415	0.020	1
157	1	19	U	H5	H	5.314	0.020	2
158	1	19	U	H5'	H	4.503	0.020	2
159	1	19	U	H5''	H	4.078	0.020	2
160	1	19	U	H6	H	7.559	0.020	1
161	1	19	U	C1'	C	93.627	0.3	1
162	1	19	U	C2	C	154.145	0.3	1
163	1	19	U	C2'	C	74.993	0.3	1
164	1	19	U	C3'	C	71.575	0.3	1
165	1	19	U	C4	C	166.441	0.3	1
166	1	19	U	C4'	C	82.063	0.3	1
167	1	19	U	C5	C	103.547	0.3	1
168	1	19	U	C5'	C	64.171	0.3	1
169	1	19	U	C6	C	140.151	0.3	1
170	1	19	U	N1	N	145.775	0.3	1
171	1	19	U	N3	N	158.410	0.3	1
172	1	19	U	P	P	-1.597	0.3	1
173	1	19	U	HO2'	H	6.859	0.020	1
174	1	20	U	H1'	H	5.422	0.020	1
175	1	20	U	H2'	H	4.192	0.020	1
176	1	20	U	H3	H	11.354	0.020	1
177	1	20	U	H3'	H	4.480	0.020	1
178	1	20	U	H4'	H	4.406	0.020	1
179	1	20	U	H5	H	5.763	0.020	2
180	1	20	U	H5'	H	4.499	0.020	2
181	1	20	U	H5''	H	4.056	0.020	2
182	1	20	U	H6	H	7.962	0.020	1
183	1	20	U	C1'	C	93.437	0.3	1
184	1	20	U	C2	C	153.974	0.3	1
185	1	20	U	C2'	C	75.448	0.3	1
186	1	20	U	C3'	C	71.978	0.3	1
187	1	20	U	C4	C	167.384	0.3	1
188	1	20	U	C4'	C	82.048	0.3	1
189	1	20	U	C5	C	104.190	0.3	1
190	1	20	U	C5'	C	64.118	0.3	1
191	1	20	U	C6	C	142.157	0.3	1
192	1	20	U	N1	N	147.015	0.3	1
193	1	20	U	N3	N	157.482	0.3	1
194	1	20	U	P	P	-1.297	0.3	1
195	1	20	U	HO2'	H	7.138	0.020	1
196	1	21	U	H1'	H	5.516	0.020	1
197	1	21	U	H2'	H	4.501	0.020	1
198	1	21	U	H3	H	10.129	0.020	1
199	1	21	U	H3'	H	4.489	0.020	1
200	1	21	U	H4'	H	4.414	0.020	1
201	1	21	U	H5	H	5.677	0.020	2
202	1	21	U	H5'	H	4.491	0.020	2
203	1	21	U	H5''	H	4.115	0.020	2
204	1	21	U	H6	H	7.837	0.020	1
205	1	21	U	C1'	C	94.025	0.3	1
206	1	21	U	C2	C	152.490	0.3	1
207	1	21	U	C2'	C	74.843	0.3	1
208	1	21	U	C3'	C	72.218	0.3	1
209	1	21	U	C4	C	168.802	0.3	1
210	1	21	U	C4'	C	82.059	0.3	1
211	1	21	U	C5	C	103.385	0.3	1
212	1	21	U	C5'	C	65.065	0.3	1
213	1	21	U	C6	C	142.823	0.3	1
214	1	21	U	N1	N	147.913	0.3	1
215	1	21	U	N3	N	155.771	0.3	1
216	1	21	U	P	P	-1.065	0.3	1
217	1	21	U	HO2'	H	6.906	0.020	1
218	1	22	A	H1'	H	6.039	0.020	1
219	1	22	A	H2	H	8.016	0.020	1
220	1	22	A	H2'	H	4.656	0.020	1
221	1	22	A	H3'	H	4.705	0.020	1
222	1	22	A	H4'	H	4.511	0.020	1
223	1	22	A	H5'	H	4.513	0.020	2
224	1	22	A	H5''	H	4.157	0.020	2
225	1	22	A	H8	H	8.241	0.020	1
226	1	22	A	H61	H	6.810	0.020	1
227	1	22	A	H62	H	7.682	0.020	1
228	1	22	A	C1'	C	91.696	0.3	1
229	1	22	A	C2	C	153.461	0.3	1
230	1	22	A	C2'	C	75.593	0.3	1
231	1	22	A	C3'	C	73.303	0.3	1
232	1	22	A	C4'	C	82.088	0.3	1
233	1	22	A	C5'	C	65.092	0.3	1
234	1	22	A	C8	C	139.854	0.3	1
235	1	22	A	N1	N	222.268	0.3	1
236	1	22	A	N3	N	214.148	0.3	1
237	1	22	A	N6	N	83.122	0.3	1
238	1	22	A	N7	N	230.948	0.3	1
239	1	22	A	N9	N	171.341	0.3	1
240	1	22	A	P	P	-0.997	0.3	1
241	1	23	C	H1'	H	5.461	0.020	1
242	1	23	C	H6	H	7.308	0.020	1
243	1	23	C	H41	H	6.907	0.020	1
244	1	23	C	H42	H	8.528	0.020	1
245	1	24	G	H1	H	12.995	0.020	1
246	1	25	C	H41	H	6.955	0.020	1
247	1	25	C	H42	H	8.599	0.020	1
248	1	26	C	H41	H	7.156	0.020	1
249	1	26	C	H42	H	8.593	0.020	1

Release date

2023-01-04

Citation

Structure of a symmetrical internal loop motif with three consecutive U:U mismatches from stem-loop 1 in the 3'-UTR of the SARS-CoV2 genomic RNA
Voegele, J., Duchardt-Ferner, E., Bains, J.K., Knezic, B., Wacker, A., Sich, C., Goerlach, M., Weigand, J., Sponer, J., Krepl, M., Schwalbe, H., Woehnert, J.

Experiments performed 19 experiments Detail

1 2D 1H-15N HSQC

Instrument

Bruker AVANCE - 900 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details 1 mM 13C,15N-A,U RNA (26-MER), 25 mM potassium phosphate, 50 mM potassium chloride, 5 % D2O, 95% H2O/5% D2O

#	Name	Isotope labeling	Concentration
5	RNA (26-MER)	[13C,15N-A,U]	1 mM
6	potassium phosphate	natural abundance	25 mM
7	potassium chloride	natural abundance	50 mM
8	D2O	natural abundance	5 %

2 2D 1H-1H NOESY

Instrument

Bruker AVANCE - 800 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details 830 uM RNA (26-MER), 25 mM potassium phosphate, 50 mM potassium chloride, 5 % D2O, 95% H2O/5% D2O

#	Name	Isotope labeling	Concentration
1	RNA (26-MER)	natural abundance	830 uM
2	potassium phosphate	natural abundance	25 mM
3	potassium chloride	natural abundance	50 mM
4	D2O	natural abundance	5 %

3 2D 1H-13C HSQC aromatic

Instrument

Bruker AVANCE - 900 MHz

Sample

#	Name	Isotope labeling	Concentration
5	RNA (26-MER)	[13C,15N-A,U]	1 mM
6	potassium phosphate	natural abundance	25 mM
7	potassium chloride	natural abundance	50 mM
8	D2O	natural abundance	5 %

4 2D 1H-13C HSQC aliphatic

Instrument

Bruker AVANCE - 900 MHz

Sample

#	Name	Isotope labeling	Concentration
5	RNA (26-MER)	[13C,15N-A,U]	1 mM
6	potassium phosphate	natural abundance	25 mM
7	potassium chloride	natural abundance	50 mM
8	D2O	natural abundance	5 %

5 2D 1H-13C HSQC aliphatic

Instrument

Bruker AVANCE - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details 1 mM 13C,15N-A,U RNA (26-MER), 25 mM potassium phosphate, 50 mM potassium chloride, 100 % D2O, 100% D2O

#	Name	Isotope labeling	Concentration
9	RNA (26-MER)	[13C,15N-A,U]	1 mM
10	potassium phosphate	natural abundance	25 mM
11	potassium chloride	natural abundance	50 mM
12	D2O	natural abundance	100 %

6 2D 1H-15N HSQC NH2 only

Instrument

Bruker AVANCE - 900 MHz

Sample

#	Name	Isotope labeling	Concentration
5	RNA (26-MER)	[13C,15N-A,U]	1 mM
6	potassium phosphate	natural abundance	25 mM
7	potassium chloride	natural abundance	50 mM
8	D2O	natural abundance	5 %

7 H56C56(C4N3)H optimized for H56

Instrument

Bruker AVANCE - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
5	RNA (26-MER)	[13C,15N-A,U]	1 mM
6	potassium phosphate	natural abundance	25 mM
7	potassium chloride	natural abundance	50 mM
8	D2O	natural abundance	5 %

8 H56C56(C4N3)H optimized for C56

Instrument

Bruker AVANCE - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
5	RNA (26-MER)	[13C,15N-A,U]	1 mM
6	potassium phosphate	natural abundance	25 mM
7	potassium chloride	natural abundance	50 mM
8	D2O	natural abundance	5 %

9 H(C)N aromatic

Instrument

Bruker AVANCE - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
9	RNA (26-MER)	[13C,15N-A,U]	1 mM
10	potassium phosphate	natural abundance	25 mM
11	potassium chloride	natural abundance	50 mM
12	D2O	natural abundance	100 %

10 H(C)N aliphatic

Instrument

Bruker AVANCE - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
9	RNA (26-MER)	[13C,15N-A,U]	1 mM
10	potassium phosphate	natural abundance	25 mM
11	potassium chloride	natural abundance	50 mM
12	D2O	natural abundance	100 %

11 H(C)P-CCH-TOCSY

Instrument

Bruker AVANCE - 700 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2, Details 1 mM 13C,15N-A,U RNA (26-MER), 25 mM potassium phosphate, 50 mM potassium chloride, 100 % D2O, 100% D2O

#	Name	Isotope labeling	Concentration
9	RNA (26-MER)	[13C,15N-A,U]	1 mM
10	potassium phosphate	natural abundance	25 mM
11	potassium chloride	natural abundance	50 mM
12	D2O	natural abundance	100 %

12 H(N)CO

Instrument

Bruker AVANCE - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
5	RNA (26-MER)	[13C,15N-A,U]	1 mM
6	potassium phosphate	natural abundance	25 mM
7	potassium chloride	natural abundance	50 mM
8	D2O	natural abundance	5 %

13 3D HCCH-COSY

Instrument

Bruker AVANCE - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
9	RNA (26-MER)	[13C,15N-A,U]	1 mM
10	potassium phosphate	natural abundance	25 mM
11	potassium chloride	natural abundance	50 mM
12	D2O	natural abundance	100 %

14 3D HCCH-TOCSY

Instrument

Bruker AVANCE - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
9	RNA (26-MER)	[13C,15N-A,U]	1 mM
10	potassium phosphate	natural abundance	25 mM
11	potassium chloride	natural abundance	50 mM
12	D2O	natural abundance	100 %

15 HCC-TOCSY-CCH-E.COSY

Instrument

Bruker AVANCE - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
9	RNA (26-MER)	[13C,15N-A,U]	1 mM
10	potassium phosphate	natural abundance	25 mM
11	potassium chloride	natural abundance	50 mM
12	D2O	natural abundance	100 %

16 3D 1H-13C NOESY aromatic

Instrument

Bruker AVANCE - 900 MHz

Sample

#	Name	Isotope labeling	Concentration
5	RNA (26-MER)	[13C,15N-A,U]	1 mM
6	potassium phosphate	natural abundance	25 mM
7	potassium chloride	natural abundance	50 mM
8	D2O	natural abundance	5 %

17 3D 1H-13C NOESY aliphatic

Instrument

Bruker AVANCE - 900 MHz

Sample

#	Name	Isotope labeling	Concentration
5	RNA (26-MER)	[13C,15N-A,U]	1 mM
6	potassium phosphate	natural abundance	25 mM
7	potassium chloride	natural abundance	50 mM
8	D2O	natural abundance	5 %

18 3D 1H-13C NOESY aromatic

Instrument

Bruker AVANCE - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
9	RNA (26-MER)	[13C,15N-A,U]	1 mM
10	potassium phosphate	natural abundance	25 mM
11	potassium chloride	natural abundance	50 mM
12	D2O	natural abundance	100 %

19 3D 1H-13C NOESY aliphatic

Instrument

Bruker AVANCE - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
9	RNA (26-MER)	[13C,15N-A,U]	1 mM
10	potassium phosphate	natural abundance	25 mM
11	potassium chloride	natural abundance	50 mM
12	D2O	natural abundance	100 %

Chemical shift validation 3 contents Detail

Properties

Input source #1: Assigned chemical shifts - Assigned chemical shifts	bmr34777_3.str
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Content subtype: bmr34777_3.str

#	Content subtype	Saveframe	Status	# of rows	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	249		96.2 (chain: 1, length: 26)
1	Chemical shift references	chem_shift_reference_1	OK	4		No information

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: 1, Chain length: 26, Sequence coverage: 96.2%

--------10--------20------
GGCGUUUUCGCUUCGGCGUUUACGCC
||||||||||||| ||||||||||||
GGCGUUUUCGCUU.GGCGUUUACGCC

Total number of assignments
- ¹H chemical shifts: 128
- ¹³C chemical shifts: 88
- ¹⁵N chemical shifts: 23
- ³¹P chemical shifts: 10

Completeness of assignments

Entity_assemble_ID: 1

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
5	U	C2	152.738
5	U	C4	168.905
5	U	N1	146.214
5	U	P	-1.232
5	U	HO2'	7.151
6	U	C2	154.042
6	U	C4	166.997
6	U	N1	146.031
6	U	P	-1.156
6	U	HO2'	6.887
7	U	C2	153.34
7	U	C4	168.093
7	U	N1	147.765
7	U	P	-1.549
7	U	HO2'	7.214
8	U	C2	152.496
8	U	C4	169.116
8	U	N1	148.81
8	U	P	-1.193
8	U	HO2'	6.83
12	U	C2	153.021
12	U	C4	167.947
12	U	N1	146.867
12	U	P	-1.266
12	U	HO2'	6.67
13	U	C2	154.934
13	U	C4	168.83
13	U	N1	143.752
13	U	P	-0.528
13	U	HO2'	6.673
18	G	H21	5.966
18	G	H22	8.596
19	U	C2	154.145
19	U	C4	166.441
19	U	N1	145.775
19	U	P	-1.597
19	U	HO2'	6.859
20	U	C2	153.974
20	U	C4	167.384
20	U	N1	147.015
20	U	P	-1.297
20	U	HO2'	7.138
21	U	C2	152.49
21	U	C4	168.802
21	U	N1	147.913
21	U	P	-1.065
21	U	HO2'	6.906
22	A	H61	6.81
22	A	H62	7.682
22	A	N1	222.268
22	A	N3	214.148
22	A	N6	83.122
22	A	N7	230.948
22	A	N9	171.341
22	A	P	-0.997

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	233	115	49.4
¹³C chemical shifts	174	70	40.2
¹⁵N chemical shifts	17	9	52.9

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	156	62	39.7
¹³C chemical shifts	130	50	38.5

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	77	53	68.8
¹³C chemical shifts	44	20	45.5
¹⁵N chemical shifts	17	9	52.9

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	10	3	30.0
¹³C chemical shifts	10	2	20.0

Histogram of normalized assigned chemical shifts

Keywords 3'-UTR, RNA, RNA structure, SARS-CoV-2, U:U mismatch

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.228 seconds)

BMRB: 34777

Experiments performed 19 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Chemical shift validation 3 contents Detail