Solution structure of a reverse transcriptase recognition site of a LINE RNA from zebrafish
Polymer type: polyribonucleotide
Total | 1H | 13C | |
---|---|---|---|
All | 24.6 % (130 of 529) | 32.6 % (97 of 298) | 14.3 % (33 of 231) |
Suger, PO4 | 9.6 % (36 of 374) | 17.6 % (36 of 204) | 0.0 % (0 of 170) |
Nucleobase | 60.6 % (94 of 155) | 64.9 % (61 of 94) | 54.1 % (33 of 61) |
Aromatic | 68.6 % (94 of 137) | 80.3 % (61 of 76) | 54.1 % (33 of 61) |
1. RNA (34-MER)
GGCGCUUUGA CACAAUCUAC AUUGUAAAAG CGCCSolvent system 100% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (34-MER) | natural abundance | RNA | 0.3 mM |
2 | RNA (34-MER) | [U-100% 13C; U-100% 15N] | RNA | 0.26 mM |
3 | sodium phosphate | natural abundance | buffer | 20 mM |
4 | sodium chloride | natural abundance | salt | 50 mM |
5 | D2O | [U-2H] | solvent | 100 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (34-MER) | natural abundance | RNA | 0.3 mM |
2 | RNA (34-MER) | [U-100% 13C; U-100% 15N] | RNA | 0.26 mM |
3 | sodium phosphate | natural abundance | buffer | 20 mM |
4 | sodium chloride | natural abundance | salt | 50 mM |
5 | D2O | [U-2H] | solvent | 100 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (34-MER) | natural abundance | RNA | 0.3 mM |
2 | RNA (34-MER) | [U-100% 13C; U-100% 15N] | RNA | 0.26 mM |
3 | sodium phosphate | natural abundance | buffer | 20 mM |
4 | sodium chloride | natural abundance | salt | 50 mM |
5 | D2O | [U-2H] | solvent | 100 % |
Bruker Avance - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (34-MER) | natural abundance | RNA | 0.3 mM |
2 | RNA (34-MER) | [U-100% 13C; U-100% 15N] | RNA | 0.26 mM |
3 | sodium phosphate | natural abundance | buffer | 20 mM |
4 | sodium chloride | natural abundance | salt | 50 mM |
5 | D2O | [U-2H] | solvent | 100 % |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (34-MER) | natural abundance | RNA | 0.3 mM |
2 | RNA (34-MER) | [U-100% 13C; U-100% 15N] | RNA | 0.26 mM |
3 | sodium phosphate | natural abundance | buffer | 20 mM |
4 | sodium chloride | natural abundance | salt | 50 mM |
5 | D2O | [U-2H] | solvent | 100 % |
Bruker Avance - 600 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
6 | RNA (34-MER) | [U-13C; U-15N]-Ade | RNA | 0.18 mM |
7 | RNA (34-MER) | [U-13C; U-15N]-Gua | RNA | 0.19 mM |
8 | sodium phosphate | natural abundance | buffer | 20 mM |
9 | sodium chloride | natural abundance | salt | 50 mM |
10 | H2O | natural abundance | solvent | 95 % |
11 | D2O | [U-2H] | solvent | 5 % |
Bruker Avance - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (34-MER) | natural abundance | RNA | 0.3 mM |
2 | RNA (34-MER) | [U-100% 13C; U-100% 15N] | RNA | 0.26 mM |
3 | sodium phosphate | natural abundance | buffer | 20 mM |
4 | sodium chloride | natural abundance | salt | 50 mM |
5 | D2O | [U-2H] | solvent | 100 % |
Bruker Avance - 600 MHz
State anisotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (34-MER) | natural abundance | RNA | 0.3 mM |
2 | RNA (34-MER) | [U-100% 13C; U-100% 15N] | RNA | 0.26 mM |
3 | sodium phosphate | natural abundance | buffer | 20 mM |
4 | sodium chloride | natural abundance | salt | 50 mM |
5 | D2O | [U-2H] | solvent | 100 % |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints | combined_11607_2rvo.nef |
Input source #2: Coordindates | 2rvo.cif |
Diamagnetism of the molecular assembly | True (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | None |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Warning |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
NoneNon-standard residues
NoneSequence alignments
--------10--------20--------30---- GGCGCUUUGACACAAUCUACAUUGUAAAAGCGCC |||||||||||||||||||||||||||||||||| GGCGCUUUGACACAAUCUACAUUGUAAAAGCGCC
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
A | A | 34 | 0 | 0 | 100.0 |
Content subtype: combined_11607_2rvo.nef
Assigned chemical shifts
--------10--------20--------30---- GGCGCUUUGACACAAUCUACAUUGUAAAAGCGCC |||||||||||||||||||||||||||||||||| GGCGCUUUGACACAAUCUACAUUGUAAAAGCGCC
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 298 | 97 | 32.6 |
13C chemical shifts | 231 | 33 | 14.3 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 204 | 36 | 17.6 |
13C chemical shifts | 170 | 0 | 0.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 94 | 61 | 64.9 |
13C chemical shifts | 61 | 33 | 54.1 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 27 | 27 | 100.0 |
13C chemical shifts | 27 | 26 | 96.3 |
Distance restraints
--------10--------20--------30---- GGCGCUUUGACACAAUCUACAUUGUAAAAGCGCC |||||||||||||||||||||||||||||||||| GGCGCUUUGACACAAUCUACAUUGUAAAAGCGCC
--------10--------20--------30---- GGCGCUUUGACACAAUCUACAUUGUAAAAGCGCC |||||||| ||| ||||||| | GGCGCUUU......AUC....UUGUAAA..C --------10--------20--------30-
--------10--------20--------30---- GGCGCUUUGACACAAUCUACAUUGUAAAAGCGCC |||||||| ||||| ||||| |||||||| GGCGCUUU...ACAAU....AUUGU.AAAGCGCC
Dihedral angle restraints
--------10--------20--------30---- GGCGCUUUGACACAAUCUACAUUGUAAAAGCGCC |||||||||||||||| |||||||| |||||||| GGCGCUUUGACACAAU.UACAUUGU.AAAGCGCC
RDC restraints
--------10--------20--------30---- GGCGCUUUGACACAAUCUACAUUGUAAAAGCGCC || | | | | || ||| | | ||||| | GG.G.U...A.A.AA.CUA.A..G..AAAGC..C