Structure of a high affinity anti-NFkB RNA aptamer
Polymer type: polyribonucleotide
Total | 1H | 13C | 15N | |
---|---|---|---|---|
All | 95.0 % (438 of 461) | 94.0 % (234 of 249) | 98.5 % (192 of 195) | 70.6 % (12 of 17) |
Suger, PO4 | 97.2 % (310 of 319) | 96.6 % (168 of 174) | 97.9 % (142 of 145) | |
Nucleobase | 90.1 % (128 of 142) | 88.0 % (66 of 75) | 100.0 % (50 of 50) | 70.6 % (12 of 17) |
Aromatic | 92.5 % (124 of 134) | 92.5 % (62 of 67) | 100.0 % (50 of 50) | 70.6 % (12 of 17) |
1. RNA
GAUACUUGAA ACUGUAAGGU UGGCGUAUCSolvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA | [U-99% 13C; U-99% 15N] | 1 (±0.2) mM | |
2 | KCl | natural abundance | 50 mM | |
3 | H20 | natural abundance | 90 % | |
4 | D2O | 10 % |
Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
5 | RNA | natural abundance | 1 (±0.2) mM | |
6 | D2O | 100 % |
Varian INOVA - 900 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
5 | RNA | natural abundance | 1 (±0.2) mM | |
6 | D2O | 100 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA | [U-99% 13C; U-99% 15N] | 1 (±0.2) mM | |
2 | KCl | natural abundance | 50 mM | |
3 | H20 | natural abundance | 90 % | |
4 | D2O | 10 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
5 | RNA | natural abundance | 1 (±0.2) mM | |
6 | D2O | 100 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA | [U-99% 13C; U-99% 15N] | 1 (±0.2) mM | |
2 | KCl | natural abundance | 50 mM | |
3 | H20 | natural abundance | 90 % | |
4 | D2O | 10 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA | [U-99% 13C; U-99% 15N] | 1 (±0.2) mM | |
2 | KCl | natural abundance | 50 mM | |
3 | H20 | natural abundance | 90 % | |
4 | D2O | 10 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA | [U-99% 13C; U-99% 15N] | 1 (±0.2) mM | |
2 | KCl | natural abundance | 50 mM | |
3 | H20 | natural abundance | 90 % | |
4 | D2O | 10 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA | [U-99% 13C; U-99% 15N] | 1 (±0.2) mM | |
2 | KCl | natural abundance | 50 mM | |
3 | H20 | natural abundance | 90 % | |
4 | D2O | 10 % |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints | combined_15538_2jwv.nef |
Input source #2: Coordindates | 2jwv.cif |
Diamagnetism of the molecular assembly | True (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | None |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Warning |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
NoneNon-standard residues
NoneSequence alignments
--------10--------20--------- GAUACUUGAAACUGUAAGGUUGGCGUAUC ||||||||||||||||||||||||||||| GAUACUUGAAACUGUAAGGUUGGCGUAUC
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
A | A | 29 | 0 | 0 | 100.0 |
Content subtype: combined_15538_2jwv.nef
Assigned chemical shifts
Comp_index_ID | Comp_ID | Atom_ID | CS value (ppm) |
---|---|---|---|
2 | A | H62 | 8.065 |
2 | A | H61 | 6.658 |
2 | A | C5 | 66.277 |
2 | A | N1 | 222.363 |
2 | A | N6 | 82.552 |
4 | A | H62 | 8.091 |
4 | A | H61 | 6.897 |
4 | A | N1 | 222.788 |
4 | A | N6 | 82.238 |
5 | C | N3 | 186.921 |
5 | C | N4 | 96.098 |
9 | A | H62 | 7.828 |
9 | A | H61 | 6.64 |
9 | A | N6 | 81.948 |
10 | A | H62 | 7.991 |
10 | A | H61 | 6.483 |
10 | A | N1 | 222.646 |
11 | A | H62 | 8.107 |
11 | A | H61 | 6.779 |
11 | A | N1 | 222.717 |
11 | A | N6 | 82.003 |
12 | C | N3 | 186.992 |
12 | C | N4 | 96.115 |
14 | G | H22 | 6.131 |
14 | G | N2 | 76.85 |
18 | G | H21 | 6.06 |
18 | G | H22 | 6.08 |
19 | G | H22 | 7.04 |
19 | G | H21 | 6.539 |
19 | G | N2 | 77.46 |
22 | G | H22 | 6.996 |
22 | G | H21 | 6.881 |
22 | G | N2 | 77.697 |
23 | G | H22 | 6.765 |
25 | G | H22 | 7.721 |
25 | G | H21 | 6.511 |
25 | G | N2 | 70.806 |
27 | A | H62 | 7.944 |
27 | A | H61 | 6.293 |
27 | A | N1 | 222.859 |
27 | A | N6 | 82.943 |
29 | C | N3 | 187.134 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 249 | 234 | 94.0 |
13C chemical shifts | 195 | 192 | 98.5 |
15N chemical shifts | 17 | 12 | 70.6 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 174 | 168 | 96.6 |
13C chemical shifts | 145 | 142 | 97.9 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 75 | 66 | 88.0 |
13C chemical shifts | 50 | 50 | 100.0 |
15N chemical shifts | 17 | 12 | 70.6 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 24 | 24 | 100.0 |
13C chemical shifts | 24 | 24 | 100.0 |
Distance restraints
Dihedral angle restraints
--------10--------20--------- GAUACUUGAAACUGUAAGGUUGGCGUAUC ||||| ||||||||||||||| |||||| GAUAC..GAAACUGUAAGGUUG.CGUAUC
RDC restraints