BMRBj - BMREntryMaster

Found 1 Document (0.29 seconds)

BMRB: 15856

2M24

NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5(gamma)

Authors

Kruschel, D., Sigel, R.K. O.

Assembly

29-MER

Entity

1. 29-MER (polymer, Thiol state: not present), 29 monomers, 9364.517 Da Detail

GGAGUAUGUA UUGGCACUGA GCAUACUCC

Formula weight

9364.517 Da

Source organism

Saccharomyces cerevisiae

Exptl. method

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 62.6 %, Completeness (bb): 51.1 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	62.6 % (290 of 463)	80.6 % (203 of 252)	39.5 % (77 of 195)	62.5 % (10 of 16)
Suger, PO4	51.1 % (163 of 319)	77.6 % (135 of 174)	19.3 % (28 of 145)
Nucleobase	88.2 % (127 of 144)	87.2 % (68 of 78)	98.0 % (49 of 50)	62.5 % (10 of 16)
Aromatic	90.2 % (119 of 132)	90.9 % (60 of 66)	98.0 % (49 of 50)	62.5 % (10 of 16)

1. RNA (29-MER)

GGAGUAUGUA UUGGCACUGA GCAUACUCC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
1	RNA (29-MER)	natural abundance		0.4-1.2 mM
2	potassium chloride	natural abundance		10 mM
3	EDTA	natural abundance		10 uM
4	MgCl2	natural abundance		0-7 mM
5	D2O	[U-100% 2H]		100 %

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
6	RNA (29-MER)	natural abundance		0.4-1.2 mM
7	potassium chloride	natural abundance		10 mM
8	EDTA	natural abundance		10 uM
9	MgCl2	natural abundance		0-8 mM
10	H2O	natural abundance		90 %
11	D2O	[U-100% 2H]		10 %

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
12	RNA (29-MER)	[selectively deuterated at 3',4',5',5'',5]		0.6 mM
13	potassium chloride	natural abundance		10 mM
14	EDTA	natural abundance		10 uM
15	D2O	[U-100% 2H]		100 %

Sample #4

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
16	RNA (29-MER)	[U-100% 13C; U-100% 15N]		0.7 mM
17	potassium chloride	natural abundance		10 mM
18	EDTA	natural abundance		10 uM
19	H2O	natural abundance		90 %
20	D2O	[U-100% 2H]		10 %

Sample #5

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
21	RNA (29-MER)	[U-100% 13C; U-100% 15N]		0.7 mM
22	potassium chloride	natural abundance		10 mM
23	EDTA	natural abundance		10 uM
24	Pf1 phage	natural abundance		25.6 mg/mL
25	H2O	natural abundance		90 %
26	D2O	[U-100% 2H]		10 %

Sample #6

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
27	RNA (29-MER)	[U-100% 13C; U-100% 15N]		1.0 mM
28	potassium chloride	natural abundance		10 mM
29	EDTA	natural abundance		10 uM
30	H2O	natural abundance		90 %
31	D2O	[U-100% 2H]		10 %

Release date

2009-10-12

Citation

NMR structure of the 5' splice site in the group IIB intron Sc.ai5γ--conformational requirements for exon-intron recognition
Kruschel, D., Sigel, R.K. O.
RNA (2014), 20, 295-307, PubMed 24448450 , DOI 10.1261/rna.041137.113 , Abstract

Related entities 1. 29-MER, : 1 : 2 entities Detail

Experiments performed 9 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
1	RNA (29-MER)	natural abundance		0.4-1.2 mM
2	potassium chloride	natural abundance		10 mM
3	EDTA	natural abundance		10 uM
4	MgCl2	natural abundance		0-7 mM
5	D2O	[U-100% 2H]		100 %

2 2D 1H-1H TOCSY

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
1	RNA (29-MER)	natural abundance		0.4-1.2 mM
2	potassium chloride	natural abundance		10 mM
3	EDTA	natural abundance		10 uM
4	MgCl2	natural abundance		0-7 mM
5	D2O	[U-100% 2H]		100 %

3 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K

#	Name	Isotope labeling	Type	Concentration
6	RNA (29-MER)	natural abundance		0.4-1.2 mM
7	potassium chloride	natural abundance		10 mM
8	EDTA	natural abundance		10 uM
9	MgCl2	natural abundance		0-8 mM
10	H2O	natural abundance		90 %
11	D2O	[U-100% 2H]		10 %

4 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
12	RNA (29-MER)	[selectively deuterated at 3',4',5',5'',5]		0.6 mM
13	potassium chloride	natural abundance		10 mM
14	EDTA	natural abundance		10 uM
15	D2O	[U-100% 2H]		100 %

5 2D 1H-13C HSQC

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Type	Concentration
16	RNA (29-MER)	[U-100% 13C; U-100% 15N]		0.7 mM
17	potassium chloride	natural abundance		10 mM
18	EDTA	natural abundance		10 uM
19	H2O	natural abundance		90 %
20	D2O	[U-100% 2H]		10 %

6 2D 1H-15N HSQC

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.8

#	Name	Isotope labeling	Type	Concentration
16	RNA (29-MER)	[U-100% 13C; U-100% 15N]		0.7 mM
17	potassium chloride	natural abundance		10 mM
18	EDTA	natural abundance		10 uM
19	H2O	natural abundance		90 %
20	D2O	[U-100% 2H]		10 %

7 2D 1H-13C HSQC

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State anisotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Type	Concentration
21	RNA (29-MER)	[U-100% 13C; U-100% 15N]		0.7 mM
22	potassium chloride	natural abundance		10 mM
23	EDTA	natural abundance		10 uM
24	Pf1 phage	natural abundance		25.6 mg/mL
25	H2O	natural abundance		90 %
26	D2O	[U-100% 2H]		10 %

8 2D 1H-15N HSQC

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State anisotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.8

#	Name	Isotope labeling	Type	Concentration
21	RNA (29-MER)	[U-100% 13C; U-100% 15N]		0.7 mM
22	potassium chloride	natural abundance		10 mM
23	EDTA	natural abundance		10 uM
24	Pf1 phage	natural abundance		25.6 mg/mL
25	H2O	natural abundance		90 %
26	D2O	[U-100% 2H]		10 %

9 2D JNN HNN-COSY

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.8

#	Name	Isotope labeling	Type	Concentration
27	RNA (29-MER)	[U-100% 13C; U-100% 15N]		1.0 mM
28	potassium chloride	natural abundance		10 mM
29	EDTA	natural abundance		10 uM
30	H2O	natural abundance		90 %
31	D2O	[U-100% 2H]		10 %

Chemical shift validation 3 contents Detail

Properties

Input source #1: Assigned chemical shifts - Assigned chemical shifts	bmr15856_3.str
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Content subtype: bmr15856_3.str

#	Content subtype	Saveframe	Status	# of rows	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	308		100.0 (chain: 1, length: 29)
1	Chemical shift references	chemical_shift_reference_1	OK	3		No information

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: 1, Chain length: 29, Sequence coverage: 100.0%

--------10--------20---------
GGAGUAUGUAUUGGCACUGAGCAUACUCC
|||||||||||||||||||||||||||||
GGAGUAUGUAUUGGCACUGAGCAUACUCC

Total number of assignments
- ¹H chemical shifts: 221
- ¹³C chemical shifts: 77
- ¹⁵N chemical shifts: 10

Completeness of assignments

Entity_assemble_ID: 1

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	H21	7.653
1	G	H22	5.645
2	G	H21	7.847
2	G	H22	5.67
3	A	H61	8.031
3	A	H62	6.71
4	G	H21	8.07
4	G	H22	5.944
6	A	H61	7.576
6	A	H62	6.179
8	G	H21	7.571
8	G	H22	5.668
21	G	H21	7.582
21	G	H22	6.031
23	A	H61	7.563
23	A	H62	6.154
25	A	H61	7.604
25	A	H62	6.15

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	252	203	80.6
¹³C chemical shifts	195	77	39.5
¹⁵N chemical shifts	16	10	62.5

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	174	135	77.6
¹³C chemical shifts	145	28	19.3

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	78	68	87.2
¹³C chemical shifts	50	49	98.0
¹⁵N chemical shifts	16	10	62.5

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	22	22	100.0
¹³C chemical shifts	22	21	95.5

Histogram of normalized assigned chemical shifts

Keywords EBS1, exon binding site 1, group II intron, hairpin, magnesium, metal ion, NMR, ribozyme, RNA 29-mer, splicing