BMRBj - BMREntryMaster

Found 1 Document (0.744 seconds)

BMRB: 15859

2K66

NMR solution structure of the d3'-stem closed by a GAAA tetraloop of the group II intron Sc.ai5(gamma)

Authors

Kruschel, D., Sigel, R.K. O.

Assembly

29-MER

Entity

1. 29-MER (polymer, Thiol state: not present), 22 monomers, 7145.245 Da Detail

GGAGUAUGUG AAAGCAUACU CC

Formula weight

7145.245 Da

Source organism

Saccharomyces cerevisiae

Exptl. method

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 66.7 %, Completeness (bb): 52.9 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	66.7 % (232 of 348)	86.8 % (164 of 189)	39.2 % (58 of 148)	90.9 % (10 of 11)
Suger, PO4	52.9 % (128 of 242)	81.1 % (107 of 132)	19.1 % (21 of 110)
Nucleobase	98.1 % (104 of 106)	100.0 % (57 of 57)	97.4 % (37 of 38)	90.9 % (10 of 11)
Aromatic	98.0 % (96 of 98)	100.0 % (49 of 49)	97.4 % (37 of 38)	90.9 % (10 of 11)

1. RNA (22-MER)

GGAGUAUGUG AAAGCAUACU CC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
1	RNA (22-MER)	natural abundance		0.9-1.3 mM
2	potassium chloride	natural abundance		10 mM
3	EDTA	natural abundance		10 uM
4	D2O	[U-100% 2H]		100 %

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
5	RNA (22-MER)	natural abundance		0.9-1.3 mM
6	potassium chloride	natural abundance		10 mM
7	EDTA	natural abundance		10 uM
8	H2O	natural abundance		90 %
9	D2O	[U-100% 2H]		10 %

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
10	RNA (22-MER)	[U-100% 13C; U-100% 15N]		1.0 mM
11	potassium chloride	natural abundance		10 mM
12	EDTA	natural abundance		10 uM
13	D2O	[U-100% 2H]		100 %

Sample #4

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
14	RNA (22-MER)	[U-100% 13C; U-100% 15N]		1.0 mM
15	potassium chloride	natural abundance		10 mM
16	EDTA	natural abundance		10 uM
17	H2O	natural abundance		90 %
18	D2O	[U-100% 2H]		10 %

Release date

2009-10-12

Citation

NMR structure of the 5' splice site in the group IIB intron Sc.ai5γ--conformational requirements for exon-intron recognition
Kruschel, D., Sigel, R.K. O.
RNA (2014), 20, 295-307, PubMed 24448450 , DOI 10.1261/rna.041137.113 , Abstract

Related entities 1. 29-MER, : 1 entities Detail

Experiments performed 6 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
1	RNA (22-MER)	natural abundance		0.9-1.3 mM
2	potassium chloride	natural abundance		10 mM
3	EDTA	natural abundance		10 uM
4	D2O	[U-100% 2H]		100 %

2 2D 1H-1H TOCSY

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Type	Concentration
1	RNA (22-MER)	natural abundance		0.9-1.3 mM
2	potassium chloride	natural abundance		10 mM
3	EDTA	natural abundance		10 uM
4	D2O	[U-100% 2H]		100 %

3 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.2

#	Name	Isotope labeling	Type	Concentration
5	RNA (22-MER)	natural abundance		0.9-1.3 mM
6	potassium chloride	natural abundance		10 mM
7	EDTA	natural abundance		10 uM
8	H2O	natural abundance		90 %
9	D2O	[U-100% 2H]		10 %

4 2D 1H-13C HSQC

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K

#	Name	Isotope labeling	Type	Concentration
10	RNA (22-MER)	[U-100% 13C; U-100% 15N]		1.0 mM
11	potassium chloride	natural abundance		10 mM
12	EDTA	natural abundance		10 uM
13	D2O	[U-100% 2H]		100 %

5 2D 1H-15N HSQC

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.4

#	Name	Isotope labeling	Type	Concentration
14	RNA (22-MER)	[U-100% 13C; U-100% 15N]		1.0 mM
15	potassium chloride	natural abundance		10 mM
16	EDTA	natural abundance		10 uM
17	H2O	natural abundance		90 %
18	D2O	[U-100% 2H]		10 %

6 2D JNN HNN-COSY

Instrument

Bruker Avance - 700 MHz equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.4

#	Name	Isotope labeling	Type	Concentration
14	RNA (22-MER)	[U-100% 13C; U-100% 15N]		1.0 mM
15	potassium chloride	natural abundance		10 mM
16	EDTA	natural abundance		10 uM
17	H2O	natural abundance		90 %
18	D2O	[U-100% 2H]		10 %

NMR combined restraints 8 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_15859_2k66.nef
Input source #2: Coordindates	2k66.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--
GGAGUAUGUGAAAGCAUACUCC
||||||||||||||||||||||
GGAGUAUGUGAAAGCAUACUCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	22	0	0	100.0

Content subtype: combined_15859_2k66.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	252		100.0 (chain: A, length: 22)
1	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	369 (1)	noe	100.0 (chain: A, length: 22)
2	Distance restraints	CNS/XPLOR_distance_constraints_5	OK	102 (1)	noe	95.5 (chain: A, length: 22)
3	Distance restraints	CNS/XPLOR_distance_constraints_7	Warning	49 (1)	noe	90.9 (chain: A, length: 22)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_9	OK	89 (89)	.	100.0 (chain: A, length: 22)
2	Dihedral angle restraints	CNS/XPLOR_dihedral_11	OK	51 (51)	.	77.3 (chain: A, length: 22)
3	Dihedral angle restraints	CNS/XPLOR_dihedral_13	OK	22 (22)	.	100.0 (chain: A, length: 22)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning
Sequence coverage of experimental data
- Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
Total number of assignments
- ¹H chemical shifts: 183
- ¹³C chemical shifts: 58
- ¹⁵N chemical shifts: 11

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	H21	7.891
1	G	H22	5.604
2	G	H21	7.822
2	G	H22	5.665
3	A	H61	8.049
3	A	H62	6.71
4	G	H21	8.082
4	G	H22	5.943
6	A	H61	7.573
6	A	H62	6.181
8	G	H21	7.628
8	G	H22	5.726
10	G	H22	5.931
14	G	H21	8.07
14	G	H22	5.937
16	A	H61	7.559
16	A	H62	6.18
18	A	H61	7.658
18	A	H62	6.165
20	U	N1	162.1

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	189	164	86.8
¹³C chemical shifts	148	58	39.2
¹⁵N chemical shifts	11	10	90.9

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	132	107	81.1
¹³C chemical shifts	110	21	19.1

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	57	57	100.0
¹³C chemical shifts	38	37	97.4
¹⁵N chemical shifts	11	10	90.9

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	20	20	100.0
¹³C chemical shifts	20	19	95.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_3
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
- Total number of restraints: 369
- Weight of restraints: 1.0 (369)
- Potential type of restraints: square-well-parabolic (369)
- Range of distance target values: 2.4, 5.5 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_5
  - Status: OK
  - Experiment type: noe
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 95.5%
  - Total number of restraints: 102
  - Weight of restraints: 1.0 (102)
  - Potential type of restraints: square-well-parabolic (102)
  - Range of distance target values: 2.4, 5.5 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map
  - Saveframe: CNS/XPLOR_distance_constraints_7
    - Status: Warning
    - Experiment type: noe
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 90.9%
    - Total number of restraints: 49
    - Weight of restraints: 1.0 (49)
    - Potential type of restraints: square-well-parabolic (49)
    - Range of distance target values: 1.95, 2.95 (Å)
    - Histogram of distance target values
    - Distance restraints per residue
      - Chain_ID: A
    - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_9
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
- Total number of restraints: 89
- Total number of restraints per polymer type: 89
- Weight of restraints: 1.0 (89)
- Potential type of restraints: square-well-parabolic (89)
- Dihedral angle restraints per residue
  - Chain_ID: A
- Saveframe: CNS/XPLOR_dihedral_11
  - Status: OK
  - Experiment type: .
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 77.3%
  - Total number of restraints: 51
  - Total number of restraints per polymer type: 51
  - Weight of restraints: 1.0 (51)
  - Potential type of restraints: square-well-parabolic (51)
  - Dihedral angle restraints per residue
    - Chain_ID: A
  - Saveframe: CNS/XPLOR_dihedral_13
    - Status: OK
    - Experiment type: .
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
    - Total number of restraints: 22
    - Total number of restraints per polymer type: 22
    - Weight of restraints: 1.0 (22)
    - Potential type of restraints: square-well-parabolic (22)
    - Dihedral angle restraints per residue
      - Chain_ID: A

Keywords d3'-stem, GAAA tetraloop, group II intron, hairpin, NMR, ribozyme, RNA 22-mer, splicing