BMRBj - BMREntryMaster

Found 1 Document (0.342 seconds)

BMRB: 16609

2KXM

1H, 13C, 15N chemical shift sssignments of the artificial neomycin-sensing riboswitch in complex with ribostamycin

Authors

Duchardt-Ferner, E.R., Schmidtke, S.R., Weigand, J.E., Suess, B., Woehnert, J.

Assembly

rna-ligand complex

Entity

1. Neo-Aptamer (polymer, Thiol state: not present), 27 monomers, 8620.002 Da Detail

GGCUGCUUGU CCUUUAAUGG UCCAGUC

2. RIO (non-polymer), 454.473 Da

Total weight

9074.475 Da

Max. entity weight

8620.002 Da

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete1

Sequence coverage: 77.8 %, Completeness: 8.8 %, Completeness (bb): 0.0 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N	³¹P
All	8.8 % (41 of 466)	11.2 % (27 of 240)	0.0 % (0 of 182)	82.4 % (14 of 17)	0.0 % (0 of 27)
Suger, PO4	0.0 % (0 of 324)	0.0 % (0 of 162)	0.0 % (0 of 135)		0.0 % (0 of 27)
Nucleobase	28.9 % (41 of 142)	34.6 % (27 of 78)	0.0 % (0 of 47)	82.4 % (14 of 17)
Aromatic	21.1 % (27 of 128)	20.3 % (13 of 64)	0.0 % (0 of 47)	82.4 % (14 of 17)

1. Neo-Aptamer

GGCUGCUUGU CCUUUAAUGG UCCAGUC

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
1	Neo-Aptamer	natural abundance	1.0 mM
2	Ribostamycin	natural abundance	1.1 mM
3	potassium cloride	natural abundance	50 mM
4	potassium phosphate	natural abundance	25 mM
5	H2O	natural abundance	90 %
6	D20	natural abundance	10 %

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
7	Neo-Aptamer	[U-15N]	1.3 mM
8	Ribostamycin	natural abundance	1.4 mM
9	potassium cloride	natural abundance	50 mM
10	potassium phosphate	natural abundance	25 mM
11	H2O	natural abundance	90 %
12	D2O	natural abundance	10 %

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
13	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
14	Ribostamycin	natural abundance	1.5 mM
15	potassium cloride	natural abundance	50 mM
16	potassium phosphate	natural abundance	25 mM
17	H2O	natural abundance	90 %
18	D2O	natural abundance	10 %

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
19	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
20	Ribostamycin	natural abundance	1.5 mM
21	potassium cloride	natural abundance	50 mM
22	potassium phosphate	natural abundance	25 mM
23	D2O	natural abundance	100 %

Sample #5

Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
24	Neo-Aptamer	[U-13C; U-15N; U-2H]	1.2 mM
25	Ribostamycin	natural abundance	1.3 mM
26	potassium cloride	natural abundance	50 mM
27	potassium phosphate	natural abundance	25 mM
28	D2O	natural abundance	100 %

Chem. Shift Complete2

Sequence coverage: 100.0 %, Completeness: 46.7 %, Completeness (bb): 46.3 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N	³¹P
All	46.7 % (435 of 932)	48.3 % (232 of 480)	49.5 % (180 of 364)	41.2 % (14 of 34)	16.7 % (9 of 54)
Suger, PO4	46.3 % (300 of 648)	48.8 % (158 of 324)	49.3 % (133 of 270)		16.7 % (9 of 54)
Nucleobase	47.5 % (135 of 284)	47.4 % (74 of 156)	50.0 % (47 of 94)	41.2 % (14 of 34)
Aromatic	47.3 % (121 of 256)	46.9 % (60 of 128)	50.0 % (47 of 94)	41.2 % (14 of 34)

1. Neo-Aptamer

GGCUGCUUGU CCUUUAAUGG UCCAGUC

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
1	Neo-Aptamer	natural abundance	1.0 mM
2	Ribostamycin	natural abundance	1.1 mM
3	potassium cloride	natural abundance	50 mM
4	potassium phosphate	natural abundance	25 mM
5	H2O	natural abundance	90 %
6	D20	natural abundance	10 %

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
7	Neo-Aptamer	[U-15N]	1.3 mM
8	Ribostamycin	natural abundance	1.4 mM
9	potassium cloride	natural abundance	50 mM
10	potassium phosphate	natural abundance	25 mM
11	H2O	natural abundance	90 %
12	D2O	natural abundance	10 %

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
13	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
14	Ribostamycin	natural abundance	1.5 mM
15	potassium cloride	natural abundance	50 mM
16	potassium phosphate	natural abundance	25 mM
17	H2O	natural abundance	90 %
18	D2O	natural abundance	10 %

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
19	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
20	Ribostamycin	natural abundance	1.5 mM
21	potassium cloride	natural abundance	50 mM
22	potassium phosphate	natural abundance	25 mM
23	D2O	natural abundance	100 %

Sample #5

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
24	Neo-Aptamer	[U-13C; U-15N; U-2H]	1.2 mM
25	Ribostamycin	natural abundance	1.3 mM
26	potassium cloride	natural abundance	50 mM
27	potassium phosphate	natural abundance	25 mM
28	D2O	natural abundance	100 %

Release date

2010-09-01

Citation

NMR resonance assignments of an engineered neomycin-sensing riboswitch RNA bound to ribostamycin and tobramycin
Schmidtke, S.R., Duchardt-Ferner, E., Weigand, J.E., Suess, B., Wohnert, J.
Biomol. NMR Assign. (2010), 4, 115-118, PubMed 20306311 , DOI 10.1007/s12104-010-9223-z , Abstract

Entries sharing articles BMRB: 2 entries Detail

  BMRB: 25526 released on 2016-01-31
    Title Re-refined solution NMR Structure of the 27 nucleotide engineered neomycin sensing riboswitch RNA-ribostamycin complex
  BMRB: 16604 released on 2010-09-01
    Title 1H, 13C, 15N chemical shift sssignments of the artificial neomycin-sensing riboswitch in complex with tobramycin

Related entities 1. Neo-Aptamer, : 1 : 2 entities Detail

Experiments performed 15 experiments Detail

1 1D 1H-HS11ECHO

Instrument

Bruker Avance - 950 MHz cryogenic probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
1	Neo-Aptamer	natural abundance	1.0 mM
2	Ribostamycin	natural abundance	1.1 mM
3	potassium cloride	natural abundance	50 mM
4	potassium phosphate	natural abundance	25 mM
5	H2O	natural abundance	90 %
6	D20	natural abundance	10 %

2 2D 1H-1H NOESY

Instrument

Bruker Avance - 950 MHz cryogenic probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
1	Neo-Aptamer	natural abundance	1.0 mM
2	Ribostamycin	natural abundance	1.1 mM
3	potassium cloride	natural abundance	50 mM
4	potassium phosphate	natural abundance	25 mM
5	H2O	natural abundance	90 %
6	D20	natural abundance	10 %

3 2D 1H-15N HSQC

Instrument

Bruker Avance - 900 MHz cryogenic probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
7	Neo-Aptamer	[U-15N]	1.3 mM
8	Ribostamycin	natural abundance	1.4 mM
9	potassium cloride	natural abundance	50 mM
10	potassium phosphate	natural abundance	25 mM
11	H2O	natural abundance	90 %
12	D2O	natural abundance	10 %

4 2D 1H-15N-HNN-COSY

Instrument

Bruker Avance - 800 MHz cryogenic probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
13	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
14	Ribostamycin	natural abundance	1.5 mM
15	potassium cloride	natural abundance	50 mM
16	potassium phosphate	natural abundance	25 mM
17	H2O	natural abundance	90 %
18	D2O	natural abundance	10 %

5 2D 1H-13C-HNCO

Instrument

Bruker Avance - 800 MHz cryogenic probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
13	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
14	Ribostamycin	natural abundance	1.5 mM
15	potassium cloride	natural abundance	50 mM
16	potassium phosphate	natural abundance	25 mM
17	H2O	natural abundance	90 %
18	D2O	natural abundance	10 %

6 2D 1H-13C H5(6)C5(6)C4N3H

Instrument

Bruker Avance - 800 MHz cryogenic probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
13	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
14	Ribostamycin	natural abundance	1.5 mM
15	potassium cloride	natural abundance	50 mM
16	potassium phosphate	natural abundance	25 mM
17	H2O	natural abundance	90 %
18	D2O	natural abundance	10 %

7 2D 1H-15N HCN

Instrument

Bruker Avance - 600 MHz cryogenic probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
19	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
20	Ribostamycin	natural abundance	1.5 mM
21	potassium cloride	natural abundance	50 mM
22	potassium phosphate	natural abundance	25 mM
23	D2O	natural abundance	100 %

8 3D 1H-15N NOESY-HSQC

Instrument

Bruker Avance - 800 MHz cryogenic probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
7	Neo-Aptamer	[U-15N]	1.3 mM
8	Ribostamycin	natural abundance	1.4 mM
9	potassium cloride	natural abundance	50 mM
10	potassium phosphate	natural abundance	25 mM
11	H2O	natural abundance	90 %
12	D2O	natural abundance	10 %

9 2D 1H-13C HSQC

Instrument

Bruker Avance - 800 MHz cryogenic probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
13	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
14	Ribostamycin	natural abundance	1.5 mM
15	potassium cloride	natural abundance	50 mM
16	potassium phosphate	natural abundance	25 mM
17	H2O	natural abundance	90 %
18	D2O	natural abundance	10 %

10 2D 1H-13C HSQC

Instrument

Bruker Avance - 800 MHz cryogenic probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
19	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
20	Ribostamycin	natural abundance	1.5 mM
21	potassium cloride	natural abundance	50 mM
22	potassium phosphate	natural abundance	25 mM
23	D2O	natural abundance	100 %

11 3D HCCH-COSY

Instrument

Bruker Avance - 600 MHz cryogenic probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
19	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
20	Ribostamycin	natural abundance	1.5 mM
21	potassium cloride	natural abundance	50 mM
22	potassium phosphate	natural abundance	25 mM
23	D2O	natural abundance	100 %

12 3D HCCH-TOCSY

Instrument

Bruker Avance - 600 MHz cryogenic probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
19	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
20	Ribostamycin	natural abundance	1.5 mM
21	potassium cloride	natural abundance	50 mM
22	potassium phosphate	natural abundance	25 mM
23	D2O	natural abundance	100 %

13 3D 1H-13C NOESY-HSQC

Instrument

Bruker Avance - 700 MHz cryogenic probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
19	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
20	Ribostamycin	natural abundance	1.5 mM
21	potassium cloride	natural abundance	50 mM
22	potassium phosphate	natural abundance	25 mM
23	D2O	natural abundance	100 %

14 3D 1H-13C NOESY-HMQC

Instrument

Bruker Avance - 900 MHz cryogenic probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
19	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
20	Ribostamycin	natural abundance	1.5 mM
21	potassium cloride	natural abundance	50 mM
22	potassium phosphate	natural abundance	25 mM
23	D2O	natural abundance	100 %

15 2D 1H-31P

Instrument

Bruker Avance - 600 MHz cryogenic probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2, Details pH 6.2

#	Name	Isotope labeling	Concentration
19	Neo-Aptamer	[U-13C; U-15N]	1.4 mM
20	Ribostamycin	natural abundance	1.5 mM
21	potassium cloride	natural abundance	50 mM
22	potassium phosphate	natural abundance	25 mM
23	D2O	natural abundance	100 %

Chemical shift validation 5 contents Detail

Properties

Input source #1: Assigned chemical shifts - Assigned chemical shifts	bmr16609_3.str
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Content subtype: bmr16609_3.str

#	Content subtype	Saveframe	Status	# of rows	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	69	85.2 (chain: 1, length: 27)
2	Assigned chemical shifts	assigned_chem_shift_list_2	Warning	421	100.0 (chain: 1, length: 27)
1	Chemical shift references	chem_shift_reference	OK	4	No information

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: 1, Chain length: 27, Sequence coverage: 85.2%

--------10--------20-------
GGCUGCUUGUCCUUUAAUGGUCCAGUC
||||||  |||||| | ||||||||||
GGCUGC..GUCCUU.A.UGGUCCAGUC

Total number of assignments
- ¹H chemical shifts: 43
- ¹⁵N chemical shifts: 26

Completeness of assignments

Entity_assemble_ID: 1

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
2	G	H21	6.089
2	G	H22	6.089
2	G	N2	72.956
3	C	N4	98.738
5	G	H21	6.996
5	G	H22	5.053
6	C	N4	95.055
11	C	N4	104.167
12	C	N4	97.029
14	U	HO2'	8.801
16	A	H61	6.543
16	A	H62	6.543
16	A	HO2'	7.749
16	A	N6	80.74
19	G	H21	8.839
19	G	H22	6.404
19	G	N2	77.007
20	G	H21	7.927
20	G	H22	5.707
20	G	N2	74.279
22	C	N4	104.247
23	C	N4	102.228
24	A	H61	7.632
24	A	H62	6.231
25	G	H21	8.131
25	G	H22	6.037
25	G	N2	74.32
27	C	N4	98.846

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	240	27	11.3
¹⁵N chemical shifts	17	14	82.4

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	162	0	0.0

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	78	27	34.6
¹⁵N chemical shifts	17	14	82.4

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	13	0	0.0

Histogram of normalized assigned chemical shifts

Saveframe: assigned_chem_shift_list_2

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: 1, Chain length: 27, Sequence coverage: 100.0%

--------10--------20-------
GGCUGCUUGUCCUUUAAUGGUCCAGUC
|||||||||||||||||||||||||||
GGCUGCUUGUCCUUUAAUGGUCCAGUC

Total number of assignments
- ¹H chemical shifts: 205
- ¹³C chemical shifts: 180
- ¹⁵N chemical shifts: 27
- ³¹P chemical shifts: 9

Completeness of assignments

Entity_assemble_ID: 1

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	N9	175.0
2	G	N9	175.5
3	C	N1	168.0
4	U	N1	165.7
5	G	N9	174.5
6	C	N1	167.0
6	C	P	-0.356
7	U	N1	164.8
7	U	P	-0.361
8	U	N1	165.8
8	U	P	-0.494
9	G	N9	174.5
9	G	P	-3.22
10	U	N1	166.9
11	C	N1	166.5
12	C	N1	168.2
13	U	N1	165.7
14	U	N1	166.5
15	U	N1	165.9
15	U	P	1.577
16	A	N9	174.6
16	A	P	0.294
17	A	N9	176.8
17	A	P	-2.783
18	U	N1	165.7
18	U	P	1.301
19	G	N9	176.4
19	G	P	-0.016
20	G	N9	174.7
21	U	N1	167.2
22	C	N1	168.2
23	C	N1	167.4
24	A	N9	176.0
25	G	N9	175.2
26	U	N1	165.5
27	C	N1	167.7

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	240	205	85.4
¹³C chemical shifts	182	180	98.9
¹⁵N chemical shifts	17	0	0.0

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	162	158	97.5
¹³C chemical shifts	135	133	98.5

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	78	47	60.3
¹³C chemical shifts	47	47	100.0
¹⁵N chemical shifts	17	0	0.0

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	13	13	100.0
¹³C chemical shifts	13	13	100.0

Histogram of normalized assigned chemical shifts

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.342 seconds)

BMRB: 16609

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Entries sharing articles BMRB: 2 entries Detail

Related entities 1. Neo-Aptamer, : 1 : 2 entities Detail

Experiments performed 15 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Chemical shift validation 5 contents Detail