Structure of a conserved retroviral RNA packaging element by NMR spectroscopy and cryo-electron tomography
Polymer type: polyribonucleotide
Total | 1H | |
---|---|---|
All | 18.2 % (208 of 1146) | 18.2 % (208 of 1146) |
Suger, PO4 | 15.0 % (118 of 786) | 15.0 % (118 of 786) |
Nucleobase | 25.0 % (90 of 360) | 25.0 % (90 of 360) |
Aromatic | 32.6 % (90 of 276) | 32.6 % (90 of 276) |
1. RNA (65-MER)
GGCGGACCCG UGGUGGAACA GACGUGUUCG GAACACCCGG CCGCAACCCU GGGAGACGUC CCAGG2. RNA (66-MER)
GGCGGACCCG UGGUGGAACA GACGUGUUCG GAACACCCGG CCGCAACCCU GGGAGACGUC CCAGGGSolvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 7.0 (±0.1), Details A series of RNAs containing different isotopic labelings were used, as described in the associated paper.
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (65-MER) | [U-2H] | 400.0 ~ 800.0 (±100.0) uM | |
2 | D2O | natural abundance | 100 (±100.0) % |
Bruker DRX - 800 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 7.0 (±0.1), Details A series of RNAs containing different isotopic labelings were used, as described in the associated paper.
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (65-MER) | [U-2H] | 400.0 ~ 800.0 (±100.0) uM | |
2 | D2O | natural abundance | 100 (±100.0) % |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 7.0 (±0.1), Details A series of RNAs containing different isotopic labelings were used, as described in the associated paper.
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (65-MER) | [U-2H] | 400.0 ~ 800.0 (±100.0) uM | |
2 | D2O | natural abundance | 100 (±100.0) % |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints | combined_17083_2l1f.nef |
Input source #2: Coordindates | 2l1f.cif |
Diamagnetism of the molecular assembly | True (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | None |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Error |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
NoneNon-standard residues
NoneSequence alignments
--310-----320-------330-------340-------350-------360-------370--- GGGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| .GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG 0--------10--------20--------30--------40--------50--------60-----
-710-----720-------730-------740-------750-------760-------770--- GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGGG --------10--------20--------30--------40--------50--------60------
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
B | A | 65 | 0 | 0 | 100.0 |
A | B | 66 | 2 | 0 | 98.5 |
Content subtype: combined_17083_2l1f.nef
Assigned chemical shifts
-710-----720-------730-------740-------750-------760-------770--- GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG |||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |||| GGCGGACC.GUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAA....GGGAGACGUC.CAGG
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 569 | 205 | 36.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 390 | 116 | 29.7 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 179 | 89 | 49.7 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 50 | 50 | 100.0 |
Distance restraints
-710-----720-------730-------740-------750-------760-------770--- GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG ||||||||||||||||||||||||||||||||||||||||||| .GCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGC -710-----720-------730-------740-------750--
-710-----720-------730-------740-------750-------760-------770--- GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG |||||||||||||||||||||||||||||||||||||||||||||| GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAA -710-----720-------730-------740-------750----
--310-----320-------330-------340-------350-------360-------370--- GGGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG ||||||||||||||||||||||||||||||||||||||||||| ..GCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGC --310-----320-------330-------340-------350--
-710-----720-------730-------740-------750-------760-------770--- GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG |||||||||||||||||||||||||||||||||||||||||||||| GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAA -710-----720-------730-------740-------750----
--310-----320-------330-------340-------350-------360-------370--- GGGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG |||||||||||||||||||||||||||||||||||||||||||||| .GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAA --310-----320-------330-------340-------350----
--310-----320-------330-------340-------350-------360-------370--- GGGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG |||||||||||||||||||||||||||||||||||||||||||||| .GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAA --310-----320-------330-------340-------350----
Dihedral angle restraints
--310-----320-------330-------340-------350-------360-------370--- GGGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG
-710-----720-------730-------740-------750-------760-------770--- GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG