BMRBj - BMREntryMaster

Found 1 Document (0.278 seconds)

BMRB: 17129

Chemical shifts of the 25-mer oligonucleotide encompassing the variable region of a MUC1 DNA aptamer.

Authors

Herve du Penhoat, C., Hantz, E., Missailidis, S., Piotto, M., Cognet, J., Baouendi, M.

Assembly

25-mer DNA oligomer

Entity

1. 25-mer DNA oligomer (polymer, Thiol state: not present), 25 monomers, 7743.914 Da Detail

GCAGTTGATC CTTTGGATAC CCTGG

Formula weight

7743.914 Da

Source organism

Homo sapiens

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 94.4 %, Completeness (bb): 95.5 % Detail

Polymer type: polydeoxyribonucleotide

	Total	¹H	³¹P
All	94.4 % (255 of 270)	93.9 % (230 of 245)	100.0 % (25 of 25)
Suger, PO4	95.5 % (191 of 200)	94.9 % (166 of 175)	100.0 % (25 of 25)
Nucleobase	91.4 % (64 of 70)	91.4 % (64 of 70)
Aromatic	96.0 % (48 of 50)	96.0 % (48 of 50)
Methyl	100.0 % (8 of 8)	100.0 % (8 of 8)

1. 25-mer oligodeoxyribonucleotide

GCAGTTGATC CTTTGGATAC CCTGG

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.5, Details 5 mm Shigemi tube

#	Name	Isotope labeling	Concentration
1	25-mer oligodeoxyribonucleotide	natural abundance	1 mM
2	sodium chloride	natural abundance	50 mM
3	sodium phosphate	natural abundance	20 mM
4	sodium azide	natural abundance	5 uM
5	H2O	natural abundance	90 %
6	D2O	natural abundance	10 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.5, Details 5 mm Shigemi tube

#	Name	Isotope labeling	Concentration
7	25-mer oligodeoxyribonucleotide	natural abundance	2 mM
8	sodium chloride	natural abundance	50 mM
9	sodium phosphate	natural abundance	20 mM
10	sodium azide	natural abundance	5 uM
11	D2O	natural abundance	100 %

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.5, Details 1.7 mm Wilmad capillary tubes

#	Name	Isotope labeling	Concentration
12	25-mer oligodeoxyribonucleotide	natural abundance	1 mM
13	sodium chloride	natural abundance	50 mM
14	sodium phosphate	natural abundance	20 mM
15	sodium azide	natural abundance	5 uM
16	H2O	natural abundance	90 %
17	D2O	natural abundance	10 %

Release date

2012-05-21

Citation

Solution structure of a truncated anti-MUC1 DNA aptamer determined by mesoscale modeling and NMR
Baouendi, M., Cognet, J.A.H., Ferreira, C.S.M., Missailidis, S., Coutant, J., Piotto, M., Hantz, E., Herve du Penhoat, C.
FEBS J. (2012), 279, 479-490, PubMed 22129448 , DOI 10.1111/j.1742-4658.2011.08440.x , Abstract

Experiments performed 11 experiments Detail

1 2D 1H-13C HSQC

Instrument

Varian UnityPlus - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.5, Details 5 mm Shigemi tube

#	Name	Isotope labeling	Concentration
7	25-mer oligodeoxyribonucleotide	natural abundance	2 mM
8	sodium chloride	natural abundance	50 mM
9	sodium phosphate	natural abundance	20 mM
10	sodium azide	natural abundance	5 uM
11	D2O	natural abundance	100 %

2 2D DQF-COSY

Instrument

Varian UnityPlus - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.5, Details 5 mm Shigemi tube

#	Name	Isotope labeling	Concentration
7	25-mer oligodeoxyribonucleotide	natural abundance	2 mM
8	sodium chloride	natural abundance	50 mM
9	sodium phosphate	natural abundance	20 mM
10	sodium azide	natural abundance	5 uM
11	D2O	natural abundance	100 %

3 2D 1H-31P HCOSYINV

Instrument

Varian UnityPlus - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.5, Details 5 mm Shigemi tube

#	Name	Isotope labeling	Concentration
7	25-mer oligodeoxyribonucleotide	natural abundance	2 mM
8	sodium chloride	natural abundance	50 mM
9	sodium phosphate	natural abundance	20 mM
10	sodium azide	natural abundance	5 uM
11	D2O	natural abundance	100 %

4 2D 1H-1H NOESY

Instrument

Varian UnityPlus - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.5, Details 5 mm Shigemi tube

#	Name	Isotope labeling	Concentration
7	25-mer oligodeoxyribonucleotide	natural abundance	2 mM
8	sodium chloride	natural abundance	50 mM
9	sodium phosphate	natural abundance	20 mM
10	sodium azide	natural abundance	5 uM
11	D2O	natural abundance	100 %

5 2D 1H-1H TOCSY

Instrument

Varian UnityPlus - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.5, Details 5 mm Shigemi tube

#	Name	Isotope labeling	Concentration
7	25-mer oligodeoxyribonucleotide	natural abundance	2 mM
8	sodium chloride	natural abundance	50 mM
9	sodium phosphate	natural abundance	20 mM
10	sodium azide	natural abundance	5 uM
11	D2O	natural abundance	100 %

6 watergate 1H-1H NOESY

Instrument

Varian UnityPlus - 500 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278.0 K, pH 6.5, Details 5 mm Shigemi tube

#	Name	Isotope labeling	Concentration
1	25-mer oligodeoxyribonucleotide	natural abundance	1 mM
2	sodium chloride	natural abundance	50 mM
3	sodium phosphate	natural abundance	20 mM
4	sodium azide	natural abundance	5 uM
5	H2O	natural abundance	90 %
6	D2O	natural abundance	10 %

7 watergate 1H-1H TOCSY

Instrument

Varian UnityPlus - 500 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278.0 K, pH 6.5, Details 5 mm Shigemi tube

#	Name	Isotope labeling	Concentration
1	25-mer oligodeoxyribonucleotide	natural abundance	1 mM
2	sodium chloride	natural abundance	50 mM
3	sodium phosphate	natural abundance	20 mM
4	sodium azide	natural abundance	5 uM
5	H2O	natural abundance	90 %
6	D2O	natural abundance	10 %

8 watergate 1H-1H NOESY

Instrument

Bruker Avance - 500 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 261.1 K, pH 6.5, Details 1.7 mm Wilmad capillary tubes

#	Name	Isotope labeling	Concentration
12	25-mer oligodeoxyribonucleotide	natural abundance	1 mM
13	sodium chloride	natural abundance	50 mM
14	sodium phosphate	natural abundance	20 mM
15	sodium azide	natural abundance	5 uM
16	H2O	natural abundance	90 %
17	D2O	natural abundance	10 %

9 g11 1H-1H NOESY

Instrument

Varian UnityPlus - 500 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 264.7 K, pH 6.5, Details 1.7 mm Wilmad capillary tubes

#	Name	Isotope labeling	Concentration
12	25-mer oligodeoxyribonucleotide	natural abundance	1 mM
13	sodium chloride	natural abundance	50 mM
14	sodium phosphate	natural abundance	20 mM
15	sodium azide	natural abundance	5 uM
16	H2O	natural abundance	90 %
17	D2O	natural abundance	10 %

10 watergate 1H-1H TOCSY

Instrument

Bruker Avance - 500 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 261.1 K, pH 6.5, Details 1.7 mm Wilmad capillary tubes

#	Name	Isotope labeling	Concentration
12	25-mer oligodeoxyribonucleotide	natural abundance	1 mM
13	sodium chloride	natural abundance	50 mM
14	sodium phosphate	natural abundance	20 mM
15	sodium azide	natural abundance	5 uM
16	H2O	natural abundance	90 %
17	D2O	natural abundance	10 %

11 2D 1H-31P HSQC_TOCSY

Instrument

Varian UnityPlus - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.5, Details 5 mm Shigemi tube

#	Name	Isotope labeling	Concentration
7	25-mer oligodeoxyribonucleotide	natural abundance	2 mM
8	sodium chloride	natural abundance	50 mM
9	sodium phosphate	natural abundance	20 mM
10	sodium azide	natural abundance	5 uM
11	D2O	natural abundance	100 %

Chemical shift validation 3 contents Detail

Properties

Input source #1: Assigned chemical shifts - Assigned chemical shifts	bmr17129_3.str
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Content subtype: bmr17129_3.str

#	Content subtype	Saveframe	Status	# of rows	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	418		100.0 (chain: 1, length: 25)
1	Chemical shift references	chemical_shift_reference_1	OK	3		No information

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: 1, Chain length: 25, Sequence coverage: 100.0%

--------10--------20-----
GCAGTTGATCCTTTGGATACCCTGG
|||||||||||||||||||||||||
GCAGTTGATCCTTTGGATACCCTGG

Total number of assignments
- ¹H chemical shifts: 254
- ¹³C chemical shifts: 139
- ³¹P chemical shifts: 25

Completeness of assignments

Entity_assemble_ID: 1

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	DG	C1'	86.6
1	DG	C2'	39.5
1	DG	C3'	77.3
1	DG	C4'	86.5
1	DG	C5'	68.1
1	DG	P	-2.67
2	DC	C1'	88.5
2	DC	C2'	39.1
2	DC	C3'	78.1
2	DC	C4'	85.4
2	DC	C5	99.1
2	DC	P	-4.03
3	DA	H61	7.87
3	DA	H62	6.59
3	DA	C1'	85.2
3	DA	C2'	39.7
3	DA	C3'	80.0
3	DA	C4'	87.8
3	DA	C5'	67.4
3	DA	P	-3.66
4	DG	C1'	84.3
4	DG	C2'	40.9
4	DG	C3'	79.4
4	DG	C4'	88.0
4	DG	P	-4.04
5	DT	C1'	86.2
5	DT	C2'	39.3
5	DT	C3'	79.4
5	DT	C6	138.5
5	DT	C7	14.0
5	DT	P	-3.95
6	DT	C2'	38.8
6	DT	C3'	78.3
6	DT	C4'	86.2
6	DT	C6	138.9
6	DT	C7	14.3
6	DT	P	-4.28
7	DG	C1'	84.9
7	DG	C2'	40.2
7	DG	C3'	79.4
7	DG	C4'	87.6
7	DG	C5'	68.5
7	DG	P	-4.22
8	DA	H61	7.73
8	DA	H62	6.05
8	DA	C1'	85.8
8	DA	C2'	41.5
8	DA	C3'	79.1
8	DA	C4'	87.6
8	DA	C5'	68.5
8	DA	C8	141.4
8	DA	P	-4.04
9	DT	C1'	87.1
9	DT	C2'	40.2
9	DT	C3'	78.7
9	DT	C4'	85.6
9	DT	C5'	66.8
9	DT	C6	138.5
9	DT	C7	14.1
9	DT	P	-4.33
10	DC	C1'	87.2
10	DC	C2'	40.4
10	DC	C3'	79.1
10	DC	C4'	86.5
10	DC	C5	98.9
10	DC	C6	140.0
10	DC	P	-4.0
11	DC	C1'	86.9
11	DC	C2'	40.6
11	DC	C3'	79.6
11	DC	C4'	87.5
11	DC	C5	98.9
11	DC	C6	139.8
11	DC	P	-3.96
12	DT	C1'	88.2
12	DT	C2'	41.3
12	DT	C3'	79.2
12	DT	C4'	87.6
12	DT	C5'	67.9
12	DT	C6	139.6
12	DT	C7	14.6
12	DT	P	-3.64
13	DT	C1'	87.8
13	DT	C2'	41.5
13	DT	C3'	79.1
13	DT	C4'	87.4
13	DT	C5'	68.1
13	DT	C6	143.6
13	DT	C7	14.7
13	DT	P	-4.46
14	DT	C1'	87.8
14	DT	C2'	40.7
14	DT	C3'	79.1
14	DT	C4'	86.9
14	DT	C5'	68.1
14	DT	C6	139.7
14	DT	C7	14.5
14	DT	P	-4.2
15	DG	C1'	84.3
15	DG	C2'	39.3
15	DG	C3'	79.4
15	DG	C4'	87.6
15	DG	C5'	69.6
15	DG	C8	140.2
15	DG	P	-4.06
16	DG	C1'	84.9
16	DG	C2'	41.1
16	DG	C3'	78.9
16	DG	C4'	87.3
16	DG	C5'	68.7
16	DG	P	-4.08
17	DA	H61	7.69
17	DA	H62	6.05
17	DA	C1'	85.2
17	DA	C2'	41.5
17	DA	C3'	78.2
17	DA	C4'	87.3
17	DA	C5'	68.5
17	DA	P	-3.9
18	DT	C1'	84.6
18	DT	C2'	38.9
18	DT	C3'	78.1
18	DT	C4'	85.3
18	DT	C5'	66.1
18	DT	C6	138.5
18	DT	P	-4.27
19	DA	H61	7.89
19	DA	H62	5.79
19	DA	C1'	85.8
19	DA	C2'	40.0
19	DA	C3'	79.6
19	DA	C4'	87.8
19	DA	P	-3.73
20	DC	C1'	86.7
20	DC	C2'	40.8
20	DC	C3'	76.0
20	DC	C4'	85.8
20	DC	C5	98.2
20	DC	C5'	67.4
20	DC	C6	142.5
20	DC	P	-4.05
21	DC	C1'	87.4
21	DC	C2'	39.7
21	DC	C3'	75.8
21	DC	C4'	86.4
21	DC	C5	98.8
21	DC	P	-3.96
22	DC	C1'	85.4
22	DC	C2'	40.0
22	DC	C3'	77.4
22	DC	C4'	86.1
22	DC	C5	99.9
22	DC	P	-4.26
23	DT	C1'	86.1
23	DT	C2'	39.1
23	DT	C3'	77.8
23	DT	C4'	86.1
23	DT	C6	139.6
23	DT	C7	14.9
23	DT	P	-4.29
24	DG	C1'	84.9
24	DG	C2'	40.3
24	DG	C3'	79.3
24	DG	C4'	86.6
24	DG	C5'	68.1
24	DG	P	-4.15
25	DG	C1'	86.2
25	DG	C2'	40.6
25	DG	C3'	78.1
25	DG	C4'	87.3
25	DG	C5'	67.7
25	DG	P	-3.89

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	245	230	93.9

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	175	166	94.9

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	70	64	91.4

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	8	8	100.0
¹³C chemical shifts	8	7	87.5

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	15	15	100.0

Histogram of normalized assigned chemical shifts

Keywords 25-mer DNA oligomer, MUC1 aptamer, NMR, structural study

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.278 seconds)

BMRB: 17129

Sample #1

Sample #2

Sample #3

Experiments performed 11 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Chemical shift validation 3 contents Detail