Properties

Disulfide bonds

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Non-standard residues

Sequence alignments

• Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20---
TAGGGTTAGGGTTAGGGTTAGGG
|||||||||||||||||||||||
TAGGGTTAGGGTTAGGGTTAGGG

Chain assignments

Content subtype: combined_17655_2ld8.nef

Assigned chemical shifts

1. Saveframe: assigned_chem_shift_list_1
   • Status: OK
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 100.0%

     --------10--------20---
     TAGGGTTAGGGTTAGGGTTAGGG
     |||||||||||||||||||||||
     TAGGGTTAGGGTTAGGGTTAGGG
     

   • Total number of assignments
     • ¹H chemical shifts: 175
   • Completeness of assignments
     • Entity_assemble_ID: A
       • All atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	214	175	81.8

       • Backbone atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	161	141	87.6

       • Side chain atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	53	34	64.2

       • Methyl group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	7	7	100.0

       • Aromatic group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	20	20	100.0

   • Histogram of normalized assigned chemical shifts

Distance restraints

1. Saveframe: CNS/XPLOR_distance_constraints_2
   • Status: Warning
   • Experiment type: noe
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 100.0%

     --------10--------20---
     TAGGGTTAGGGTTAGGGTTAGGG
     |||||||||||||||||||||||
     TAGGGTTAGGGTTAGGGTTAGGG
     

   • Total number of restraints: 329
     • Intra-residue restraints, i = j : 141
     • Sequential restraints, | i - j | = 1 : 110
       • Backbone-backbone: 3
       • Backbone-side chain: 77
       • Side chain-side chain: 30
     • Medium range restraints, 1 < | i - j | < 5 : 60
       • Backbone-side chain: 36
       • Side chain-side chain: 24
     • Long range restraints, | i - j | >= 5 : 18
   • Weight of restraints: 1.0 (329)
     • Intra-residue restraints, i = j : 1.0 (141)
     • Sequential restraints, | i - j | = 1 : 1.0 (110)
       • Backbone-backbone: 1.0 (3)
       • Backbone-side chain: 1.0 (77)
       • Side chain-side chain: 1.0 (30)
     • Medium range restraints, 1 < | i - j | < 5 : 1.0 (60)
       • Backbone-side chain: 1.0 (36)
       • Side chain-side chain: 1.0 (24)
     • Long range restraints, | i - j | >= 5 : 1.0 (18)
   • Potential type of restraints: square-well-parabolic (329)
     • Intra-residue restraints, i = j : square-well-parabolic (141)
     • Sequential restraints, | i - j | = 1 : square-well-parabolic (110)
       • Backbone-backbone: square-well-parabolic (3)
       • Backbone-side chain: square-well-parabolic (77)
       • Side chain-side chain: square-well-parabolic (30)
     • Medium range restraints, 1 < | i - j | < 5 : square-well-parabolic (60)
       • Backbone-side chain: square-well-parabolic (36)
       • Side chain-side chain: square-well-parabolic (24)
     • Long range restraints, | i - j | >= 5 : square-well-parabolic (18)
   • Range of distance target values: 2.8, 42.75 (Å)
   • Histogram of distance target values
   • Histogram of discrepancy in distance target values
   • Distance restraints per residue
     • Chain_ID: A
   • Distance restraints on contact map
     • Chain_ID_1: A - Chain_ID_2: A

Dihedral angle restraints

1. Saveframe: CNS/XPLOR_dihedral_4
   • Status: OK
   • Experiment type: .
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 69.6%

     --------10--------20---
     TAGGGTTAGGGTTAGGGTTAGGG
      |||||  ||||  ||||  |||
     .AGGGT..GGGT..GGGT..GGG
     

   • Total number of restraints: 36
     • Chi angle constraints: 12
     • Undefined angle constraints: 13
     • Epsilon angle constraints: 11
   • Total number of restraints per polymer type: 36
     • Nucleic acid: 36
   • Weight of restraints: 1.0 (36)
     • Chi angle constraints: 1.0 (12)
     • Undefined angle constraints: 1.0 (13)
     • Epsilon angle constraints: 1.0 (11)
   • Potential type of restraints: square-well-parabolic (36)
     • Chi angle constraints: square-well-parabolic (12)
     • Undefined angle constraints: square-well-parabolic (13)
     • Epsilon angle constraints: square-well-parabolic (11)
   • Dihedral angle restraints per residue
     • Chain_ID: A