The 912-888 alternate conformation for helix 27 of E.coli 16S rRNA
Polymer type: polyribonucleotide
Total | 1H | 13C | 15N | |
---|---|---|---|---|
All | 37.7 % (185 of 491) | 54.1 % (146 of 270) | 18.8 % (39 of 207) | 0.0 % (0 of 14) |
Suger, PO4 | 22.6 % (77 of 341) | 41.4 % (77 of 186) | 0.0 % (0 of 155) | |
Nucleobase | 72.0 % (108 of 150) | 82.1 % (69 of 84) | 75.0 % (39 of 52) | 0.0 % (0 of 14) |
Aromatic | 76.5 % (101 of 132) | 93.9 % (62 of 66) | 75.0 % (39 of 52) | 0.0 % (0 of 14) |
1. RNA (31-MER)
GGGGAGUACG GCCGCAAGGU UAAAACUCCC CSolvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K, pH 6.4, Details Final RNA concentrations for the samples ranged from 0.8 to 1.6 mM, as quantified by UV absorption
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER) | [U-99% 13C; U-99% 15N] | 0.8 ~ 1.6 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | natural abundance | 10 % | |
4 | NaPi | natural abundance | 10 mM | |
5 | EDTA | natural abundance | 0.1 mM | |
6 | NaCl | natural abundance | 50 mM |
Varian INOVA - 800 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K, pH 6.4, Details Final RNA concentrations for the samples ranged from 0.8 to 1.6 mM, as quantified by UV absorption
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER) | [U-99% 13C; U-99% 15N] | 0.8 ~ 1.6 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | natural abundance | 10 % | |
4 | NaPi | natural abundance | 10 mM | |
5 | EDTA | natural abundance | 0.1 mM | |
6 | NaCl | natural abundance | 50 mM |
Varian INOVA - 800 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K, pH 6.4, Details Final RNA concentrations for the samples ranged from 0.8 to 1.6 mM, as quantified by UV absorption
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER) | [U-99% 13C; U-99% 15N] | 0.8 ~ 1.6 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | natural abundance | 10 % | |
4 | NaPi | natural abundance | 10 mM | |
5 | EDTA | natural abundance | 0.1 mM | |
6 | NaCl | natural abundance | 50 mM |
Varian INOVA - 800 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K, pH 6.4, Details Final RNA concentrations for the samples ranged from 0.8 to 1.6 mM, as quantified by UV absorption
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER) | [U-99% 13C; U-99% 15N] | 0.8 ~ 1.6 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | natural abundance | 10 % | |
4 | NaPi | natural abundance | 10 mM | |
5 | EDTA | natural abundance | 0.1 mM | |
6 | NaCl | natural abundance | 50 mM |
Varian INOVA - 800 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K, pH 6.4, Details Final RNA concentrations for the samples ranged from 0.8 to 1.6 mM, as quantified by UV absorption
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER) | [U-99% 13C; U-99% 15N] | 0.8 ~ 1.6 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | natural abundance | 10 % | |
4 | NaPi | natural abundance | 10 mM | |
5 | EDTA | natural abundance | 0.1 mM | |
6 | NaCl | natural abundance | 50 mM |
Varian INOVA - 800 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K, pH 6.4, Details Final RNA concentrations for the samples ranged from 0.8 to 1.6 mM, as quantified by UV absorption
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (31-MER) | [U-99% 13C; U-99% 15N] | 0.8 ~ 1.6 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | natural abundance | 10 % | |
4 | NaPi | natural abundance | 10 mM | |
5 | EDTA | natural abundance | 0.1 mM | |
6 | NaCl | natural abundance | 50 mM |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints | combined_17682_2ldt.nef |
Input source #2: Coordindates | 2ldt.cif |
Diamagnetism of the molecular assembly | True (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | None |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Warning |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
NoneNon-standard residues
NoneSequence alignments
--------10--------20--------30- GGGGAGUACGGCCGCAAGGUUAAAACUCCCC ||||||||||||||||||||||||||||||| GGGGAGUACGGCCGCAAGGUUAAAACUCCCC
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
A | A | 31 | 0 | 0 | 100.0 |
Content subtype: combined_17682_2ldt.nef
Assigned chemical shifts
Comp_index_ID | Comp_ID | Atom_ID | CS value (ppm) |
---|---|---|---|
2 | G | H21 | 8.41 |
3 | G | H22 | 5.345 |
4 | G | H22 | 8.217 |
4 | G | H21 | 5.682 |
5 | A | H62 | 7.787 |
5 | A | H61 | 5.483 |
5 | A | N1 | 155.124 |
6 | G | H22 | 7.868 |
6 | G | H21 | 5.715 |
8 | A | N1 | 154.956 |
11 | G | H22 | 6.458 |
11 | G | H21 | 5.286 |
16 | A | N1 | 155.214 |
17 | A | N1 | 155.617 |
18 | G | H21 | 8.455 |
22 | A | N1 | 154.931 |
23 | A | N1 | 154.214 |
24 | A | N1 | 155.727 |
25 | A | N1 | 153.868 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 270 | 146 | 54.1 |
13C chemical shifts | 207 | 39 | 18.8 |
15N chemical shifts | 14 | 0 | 0.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 186 | 77 | 41.4 |
13C chemical shifts | 155 | 0 | 0.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 84 | 69 | 82.1 |
13C chemical shifts | 52 | 39 | 75.0 |
15N chemical shifts | 14 | 0 | 0.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 26 | 26 | 100.0 |
13C chemical shifts | 26 | 26 | 100.0 |
Distance restraints
Dihedral angle restraints
--------10--------20--------30- GGGGAGUACGGCCGCAAGGUUAAAACUCCCC ||||||||||||||||||||||||||||||| GGGGAGUACGGCCGCAAGGUUAAAACUCCCC
--------10--------20--------30- GGGGAGUACGGCCGCAAGGUUAAAACUCCCC |||||| ||| | |||| ||||||| GGGGAG...GGC.G..AGGU....ACUCCCC
--------10--------20--------30- GGGGAGUACGGCCGCAAGGUUAAAACUCCCC |||||||| || | |||||||||||||||| GGGGAGUA.GG..G.AAGGUUAAAACUCCCC
--------10--------20--------30- GGGGAGUACGGCCGCAAGGUUAAAACUCCCC ||||||||||||||||||||| || |||||| GGGGAGUACGGCCGCAAGGUU.AA.CUCCCC
RDC restraints