BMRBj - BMREntryMaster

Found 1 Document (0.468 seconds)

BMRB: 18891

2M21

Solution structure of the Tetrahymena telomerase RNA stem IV terminal loop

Authors

Cash, D.D., Richards, R.J., Wu, H., Trantirek, L., O'Connor, C.M., Feigon, J., Collins, K.

Assembly

Tetrahymena telomerase RNA stem IV terminal loop

Entity

1. Tetrahymena telomerase RNA stem IV terminal loop (polymer, Thiol state: not present), 21 monomers, 6712.951 Da Detail

GGCGAUACAC UAUUUAUCGC C

Formula weight

6712.951 Da

Source organism

Tetrahymena thermophila

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 95.9 %, Completeness (bb): 100.0 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	95.9 % (325 of 339)	96.2 % (179 of 186)	98.6 % (141 of 143)	50.0 % (5 of 10)
Suger, PO4	100.0 % (231 of 231)	100.0 % (126 of 126)	100.0 % (105 of 105)
Nucleobase	87.0 % (94 of 108)	88.3 % (53 of 60)	94.7 % (36 of 38)	50.0 % (5 of 10)
Aromatic	89.6 % (86 of 96)	93.8 % (45 of 48)	94.7 % (36 of 38)	50.0 % (5 of 10)

1. stemIV telo RNA

GGCGAUACAC UAUUUAUCGC C

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.3

#	Name	Isotope labeling	Concentration
1	stemIV_telo_RNA	unlabeled	0.6 ~ 1.0 mM
2	potassium chloride	natural abundance	20 mM
3	sodium azide	natural abundance	0.2 %
4	EDTA	natural abundance	50 uM
5	sodium phosphate	natural abundance	10 mM
6	H2O	natural abundance	90 %
7	D2O	natural abundance	10 %

Sample #2

Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.3

#	Name	Isotope labeling	Concentration
8	stemIV_telo_RNA	13C,15N uniformly labelled	0.6 ~ 1.0 mM
9	sodium phosphate	natural abundance	10 mM
10	potassium chloride	natural abundance	20 mM
11	sodium azide	natural abundance	0.2 %
12	EDTA	natural abundance	50 uM
13	H2O	natural abundance	90 %
14	D2O	natural abundance	10 %

Release date

2013-01-23

Citation

Structural study of elements of Tetrahymena telomerase RNA stem-loop IV domain important for function
Richards, R.J., Wu, H., Trantirek, L., O'Connor, C.M., Collins, K., Feigon, J.
RNA (2006), 12, 1475-1485, PubMed 16809815 , DOI 10.1261/rna.112306 , Abstract

Related entities 1. Tetrahymena telomerase RNA stem IV terminal loop, : 1 entities Detail

Experiments performed 7 experiments Detail

1 11echo and watergate

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.3

#	Name	Isotope labeling	Concentration
1	stemIV_telo_RNA	unlabeled	0.6 ~ 1.0 mM
2	potassium chloride	natural abundance	20 mM
3	sodium azide	natural abundance	0.2 %
4	EDTA	natural abundance	50 uM
5	sodium phosphate	natural abundance	10 mM
6	H2O	natural abundance	90 %
7	D2O	natural abundance	10 %

2 2D TOCSY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.3

#	Name	Isotope labeling	Concentration
1	stemIV_telo_RNA	unlabeled	0.6 ~ 1.0 mM
2	potassium chloride	natural abundance	20 mM
3	sodium azide	natural abundance	0.2 %
4	EDTA	natural abundance	50 uM
5	sodium phosphate	natural abundance	10 mM
6	H2O	natural abundance	90 %
7	D2O	natural abundance	10 %

3 2D NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.3

#	Name	Isotope labeling	Concentration
1	stemIV_telo_RNA	unlabeled	0.6 ~ 1.0 mM
2	potassium chloride	natural abundance	20 mM
3	sodium azide	natural abundance	0.2 %
4	EDTA	natural abundance	50 uM
5	sodium phosphate	natural abundance	10 mM
6	H2O	natural abundance	90 %
7	D2O	natural abundance	10 %

4 2D 15N-HMQC, 2D 15N-CPMG-NOESY, 2D JNN-HNN-COSY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.3

#	Name	Isotope labeling	Concentration
8	stemIV_telo_RNA	13C,15N uniformly labelled	0.6 ~ 1.0 mM
9	sodium phosphate	natural abundance	10 mM
10	potassium chloride	natural abundance	20 mM
11	sodium azide	natural abundance	0.2 %
12	EDTA	natural abundance	50 uM
13	H2O	natural abundance	90 %
14	D2O	natural abundance	10 %

5 2D 13C-HSQCs

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.3

#	Name	Isotope labeling	Concentration
8	stemIV_telo_RNA	13C,15N uniformly labelled	0.6 ~ 1.0 mM
9	sodium phosphate	natural abundance	10 mM
10	potassium chloride	natural abundance	20 mM
11	sodium azide	natural abundance	0.2 %
12	EDTA	natural abundance	50 uM
13	H2O	natural abundance	90 %
14	D2O	natural abundance	10 %

6 2D HCCH COSY, 3D HCCH-TOCSY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.3

#	Name	Isotope labeling	Concentration
8	stemIV_telo_RNA	13C,15N uniformly labelled	0.6 ~ 1.0 mM
9	sodium phosphate	natural abundance	10 mM
10	potassium chloride	natural abundance	20 mM
11	sodium azide	natural abundance	0.2 %
12	EDTA	natural abundance	50 uM
13	H2O	natural abundance	90 %
14	D2O	natural abundance	10 %

7 3D 1H,13C HMQCs

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.3

#	Name	Isotope labeling	Concentration
8	stemIV_telo_RNA	13C,15N uniformly labelled	0.6 ~ 1.0 mM
9	sodium phosphate	natural abundance	10 mM
10	potassium chloride	natural abundance	20 mM
11	sodium azide	natural abundance	0.2 %
12	EDTA	natural abundance	50 uM
13	H2O	natural abundance	90 %
14	D2O	natural abundance	10 %

NMR combined restraints 6 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_18891_2m21.nef
Input source #2: Coordindates	2m21.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20-
GGCGAUACACUAUUUAUCGCC
|||||||||||||||||||||
GGCGAUACACUAUUUAUCGCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	21	0	0	100.0

Content subtype: combined_18891_2m21.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	OK	341		100.0 (chain: A, length: 21)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	457 (1)	noe	100.0 (chain: A, length: 21)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	37 (1)	hbond	76.2 (chain: A, length: 21)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_4	OK	151 (151)	.	100.0 (chain: A, length: 21)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_5	OK	53 (53)	.	90.5 (chain: A, length: 21)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: OK
Sequence coverage of experimental data
- Entity_assembly_ID: A, Chain length: 21, Sequence coverage: 100.0%
Total number of assignments
- ¹H chemical shifts: 181
- ¹³C chemical shifts: 141
- ¹⁵N chemical shifts: 19

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
3	C	N4	98.348
5	A	N1	212.467
5	A	N3	222.031
5	A	N6	83.899
7	A	H61	6.22
7	A	H62	7.527
7	A	N1	213.217
7	A	N3	222.204
7	A	N6	83.088
15	U	N1	161.93
16	A	N1	212.794
16	A	N3	222.146
16	A	N6	83.92
18	C	N4	97.728
20	C	N4	99.108
21	C	N4	97.517

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	186	179	96.2
¹³C chemical shifts	143	141	98.6
¹⁵N chemical shifts	10	5	50.0

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	126	126	100.0
¹³C chemical shifts	105	105	100.0

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	60	53	88.3
¹³C chemical shifts	38	36	94.7
¹⁵N chemical shifts	10	5	50.0

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	14	14	100.0
¹³C chemical shifts	14	14	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 21, Sequence coverage: 100.0%
- Total number of restraints: 457
- Weight of restraints: 1.0 (457)
- Potential type of restraints: square-well-parabolic (457)
- Range of distance target values: 2.65, 15.95 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 21, Sequence coverage: 76.2%
  - Total number of restraints: 37
  - Weight of restraints: 1.0 (37)
  - Potential type of restraints: square-well-parabolic (37)
  - Range of distance target values: 2.0, 2.9 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_4
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 21, Sequence coverage: 100.0%
- Total number of restraints: 151
- Total number of restraints per polymer type: 151
- Weight of restraints: 1.0 (151)
- Potential type of restraints: square-well-parabolic (151)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_5
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 21, Sequence coverage: 90.5%
- Total number of restraints: 53
- Potential type of restraints: square-well-parabolic (53)
- Range of observed RDC values: -34.37, 32.65 (Hz)
- Histogram of observed RDC values
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords biomolecular, ciliate, genetic, holoenzyme, Models, Molecular, nuclear magnetic resonance, nucleic acid, protein, protozoan proteins, reverse transcriptase, RNA, secondary, structure, telomerase, template, tertiary, tetrahymena thermophila

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.468 seconds)

BMRB: 18891

Sample #1

Sample #2

Related entities 1. Tetrahymena telomerase RNA stem IV terminal loop, : 1 entities Detail

Experiments performed 7 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 6 contents Detail