BMRBj - BMREntryMaster

Found 1 Document (0.389 seconds)

BMRB: 19698

2MIY

Solution NMR structure of a preQ1 Class II riboswitch from Streptococcus pneumoniae

Authors

Kang, M., Eichhorn, C.D., Feigon, J.

Assembly

preQ1 Class II riboswitch from Streptococcus pneumoniae

Entity

1. RNA (59-MER) (polymer, Thiol state: not present), 59 monomers, 18966.23 Da Detail

GCUUGGUGCU UAGCUUCUUU CACCAAGCAU AUUACACGCG GAUAACCGCC AAAGGAGAA

2. 7-DEAZA-7-AMINOMETHYL-GUANINE (non-polymer), 179.179 Da

Total weight

19145.41 Da

Max. entity weight

18966.23 Da

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete1

Sequence coverage: 100.0 %, Completeness: 54.0 %, Completeness (bb): 39.4 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	54.0 % (509 of 943)	64.9 % (335 of 516)	38.5 % (154 of 400)	74.1 % (20 of 27)
Suger, PO4	39.4 % (256 of 649)	56.2 % (199 of 354)	19.3 % (57 of 295)
Nucleobase	86.1 % (253 of 294)	84.0 % (136 of 162)	92.4 % (97 of 105)	74.1 % (20 of 27)
Aromatic	92.0 % (243 of 264)	95.5 % (126 of 132)	92.4 % (97 of 105)	74.1 % (20 of 27)

1. RNA (59-MER)

GCUUGGUGCU UAGCUUCUUU CACCAAGCAU AUUACACGCG GAUAACCGCC AAAGGAGAA

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 300 K, pH 6.15 (±0.15), Details classII_H2O

#	Name	Isotope labeling	Concentration
1	RNA (59-MER)	natural abundance	1.0 ~ 1.2 mM
2	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
3	potassium chloride	natural abundance	60 mM
4	calcium chloride	natural abundance	3 mM
5	H2O	natural abundance	90 %
6	D2O	[U-100% 2H]	10 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.15 (±0.15), Details classII_D2O

#	Name	Isotope labeling	Concentration
7	RNA (59-MER)	natural abundance	1.0 ~ 1.2 mM
8	potassium chloride	natural abundance	60 mM
9	calcium chloride	natural abundance	3 mM
10	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
11	D2O	[U-100% 2H]	100 %

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.15 (±0.15), Details classII_partially Deuterated

#	Name	Isotope labeling	Concentration
12	RNA (59-MER)	[U-50% 2H	0.8 ~ 1.0 mM
13	potassium chloride	natural abundance	60 mM
14	calcium Chloride	natural abundance	3 mM
15	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
16	D2O	[U-100% 2H]	100 %

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.15 (±0.15), Details classII_D2O_A

#	Name	Isotope labeling	Concentration
17	RNA (59-MER)	[U-13C; U-15N]-Ade	1.0 ~ 1.2 mM
18	potassium chloride	natural abundance	60 mM
19	calcium chloride	natural abundance	3 mM
20	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
21	D2O	[U-100% 2H]	100 %

Sample #5

Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.15 (±0.15), Details classII_D2O_G

#	Name	Isotope labeling	Concentration
22	RNA (59-MER)	[U-13C; U-15N]-Gua	1~1.2 mM
23	potassium chloride	natural abundance	60 mM
24	calcium chloride	natural abundance	3 mM
25	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
26	D2O	[U-100% 2H]	100 %

Sample #6

Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.15 (±0.15), Details classII_D2O_C

#	Name	Isotope labeling	Concentration
27	RNA (59-MER)	[U-13C; U-15N]-Cyt	1~1.2 mM
28	potassium chloride	natural abundance	60 mM
29	calcium chloride	natural abundance	3 mM
30	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
31	D2O	[U-100% 2H]	100 %

Sample #7

Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.15 (±0.15), Details classII_D2O_U

#	Name	Isotope labeling	Concentration
32	RNA (59-MER)	[U-13C; U-15N]-Ura	1~1.2 mM
33	potassium chloride	natural abundance	60 mM
34	calcium chloride	natural abundance	3 mM
35	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
36	D2O	[U-100% 2H]	100 %

Sample #8

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 300 K, pH 6.15 (±0.15), Details classII_H2O_full

#	Name	Isotope labeling	Concentration
37	RNA (59-MER)	[U-100% 13C; U-100% 15N]	1~1.2 mM
38	potassium chloride	natural abundance	60 mM
39	calcium chloride	natural abundance	3 mM
40	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
41	H2O	natural abundance	90 %
42	D2O	[U-100% 2H]	10 %

Chem. Shift Complete2

Sequence coverage: 94.9 %, Completeness: 56.4 %, Completeness (bb): 61.2 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	56.4 % (1064 of 1886)	61.1 % (631 of 1032)	51.6 % (413 of 800)	37.0 % (20 of 54)
Suger, PO4	61.2 % (795 of 1298)	68.5 % (485 of 708)	52.5 % (310 of 590)
Nucleobase	45.7 % (269 of 588)	45.1 % (146 of 324)	49.0 % (103 of 210)	37.0 % (20 of 54)
Aromatic	48.3 % (255 of 528)	50.0 % (132 of 264)	49.0 % (103 of 210)	37.0 % (20 of 54)

1. RNA (59-MER)

GCUUGGUGCU UAGCUUCUUU CACCAAGCAU AUUACACGCG GAUAACCGCC AAAGGAGAA

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 310 K, pH 6.15 (±0.15), Details classII_H2O

#	Name	Isotope labeling	Concentration
1	RNA (59-MER)	natural abundance	1.0 ~ 1.2 mM
2	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
3	potassium chloride	natural abundance	60 mM
4	calcium chloride	natural abundance	3 mM
5	H2O	natural abundance	90 %
6	D2O	[U-100% 2H]	10 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 310 K, pH 6.15 (±0.15), Details classII_D2O

#	Name	Isotope labeling	Concentration
7	RNA (59-MER)	natural abundance	1.0 ~ 1.2 mM
8	potassium chloride	natural abundance	60 mM
9	calcium chloride	natural abundance	3 mM
10	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
11	D2O	[U-100% 2H]	100 %

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 310 K, pH 6.15 (±0.15), Details classII_partially Deuterated

#	Name	Isotope labeling	Concentration
12	RNA (59-MER)	[U-50% 2H	0.8 ~ 1.0 mM
13	potassium chloride	natural abundance	60 mM
14	calcium Chloride	natural abundance	3 mM
15	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
16	D2O	[U-100% 2H]	100 %

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 310 K, pH 6.15 (±0.15), Details classII_D2O_A

#	Name	Isotope labeling	Concentration
17	RNA (59-MER)	[U-13C; U-15N]-Ade	1.0 ~ 1.2 mM
18	potassium chloride	natural abundance	60 mM
19	calcium chloride	natural abundance	3 mM
20	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
21	D2O	[U-100% 2H]	100 %

Sample #5

Solvent system 100% D2O, Pressure 1 atm, Temperature 310 K, pH 6.15 (±0.15), Details classII_D2O_G

#	Name	Isotope labeling	Concentration
22	RNA (59-MER)	[U-13C; U-15N]-Gua	1~1.2 mM
23	potassium chloride	natural abundance	60 mM
24	calcium chloride	natural abundance	3 mM
25	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
26	D2O	[U-100% 2H]	100 %

Sample #6

Solvent system 100% D2O, Pressure 1 atm, Temperature 310 K, pH 6.15 (±0.15), Details classII_D2O_C

#	Name	Isotope labeling	Concentration
27	RNA (59-MER)	[U-13C; U-15N]-Cyt	1~1.2 mM
28	potassium chloride	natural abundance	60 mM
29	calcium chloride	natural abundance	3 mM
30	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
31	D2O	[U-100% 2H]	100 %

Sample #7

Solvent system 100% D2O, Pressure 1 atm, Temperature 310 K, pH 6.15 (±0.15), Details classII_D2O_U

#	Name	Isotope labeling	Concentration
32	RNA (59-MER)	[U-13C; U-15N]-Ura	1~1.2 mM
33	potassium chloride	natural abundance	60 mM
34	calcium chloride	natural abundance	3 mM
35	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
36	D2O	[U-100% 2H]	100 %

Sample #8

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 310 K, pH 6.15 (±0.15), Details classII_H2O_full

#	Name	Isotope labeling	Concentration
37	RNA (59-MER)	[U-100% 13C; U-100% 15N]	1~1.2 mM
38	potassium chloride	natural abundance	60 mM
39	calcium chloride	natural abundance	3 mM
40	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
41	H2O	natural abundance	90 %
42	D2O	[U-100% 2H]	10 %

Release date

2014-01-26

Citation

Structural determinants for ligand capture by a class II preQ1 riboswitch
Kang, M., Eichhorn, C.D., Feigon, J.
Proc. Natl. Acad. Sci. U. S. A. (2014), 111, E663-E671, PubMed 24469808 , DOI 10.1073/pnas.1400126111 , Abstract

Related entities 1. RNA (59-MER), : 1 entities Detail

Experiments performed 10 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker DRX - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 300 K, pH 6.15 (±0.15), Details classII_H2O

#	Name	Isotope labeling	Concentration
1	RNA (59-MER)	natural abundance	1.0 ~ 1.2 mM
2	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
3	potassium chloride	natural abundance	60 mM
4	calcium chloride	natural abundance	3 mM
5	H2O	natural abundance	90 %
6	D2O	[U-100% 2H]	10 %

2 2D 1H-1H TOCSY

Instrument

Bruker DRX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.15 (±0.15), Details classII_D2O

#	Name	Isotope labeling	Concentration
7	RNA (59-MER)	natural abundance	1.0 ~ 1.2 mM
8	potassium chloride	natural abundance	60 mM
9	calcium chloride	natural abundance	3 mM
10	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
11	D2O	[U-100% 2H]	100 %

3 3D HCCH-TOCSY

Instrument

Bruker DRX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 310 K, pH 6.15 (±0.15), Details classII_D2O_A

#	Name	Isotope labeling	Concentration
17	RNA (59-MER)	[U-13C; U-15N]-Ade	1.0 ~ 1.2 mM
18	potassium chloride	natural abundance	60 mM
19	calcium chloride	natural abundance	3 mM
20	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
21	D2O	[U-100% 2H]	100 %

4 3D HCCH-TOCSY

Instrument

Bruker DRX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 310 K, pH 6.15 (±0.15), Details classII_D2O_G

#	Name	Isotope labeling	Concentration
22	RNA (59-MER)	[U-13C; U-15N]-Gua	1~1.2 mM
23	potassium chloride	natural abundance	60 mM
24	calcium chloride	natural abundance	3 mM
25	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
26	D2O	[U-100% 2H]	100 %

5 3D HCCH-TOCSY

Instrument

Bruker DRX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 310 K, pH 6.15 (±0.15), Details classII_D2O_C

#	Name	Isotope labeling	Concentration
27	RNA (59-MER)	[U-13C; U-15N]-Cyt	1~1.2 mM
28	potassium chloride	natural abundance	60 mM
29	calcium chloride	natural abundance	3 mM
30	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
31	D2O	[U-100% 2H]	100 %

6 3D HCCH-TOCSY

Instrument

Bruker DRX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 310 K, pH 6.15 (±0.15), Details classII_D2O_U

#	Name	Isotope labeling	Concentration
32	RNA (59-MER)	[U-13C; U-15N]-Ura	1~1.2 mM
33	potassium chloride	natural abundance	60 mM
34	calcium chloride	natural abundance	3 mM
35	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
36	D2O	[U-100% 2H]	100 %

7 2D 1H-1H NOESY

Instrument

Bruker DRX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.15 (±0.15), Details classII_partially Deuterated

#	Name	Isotope labeling	Concentration
12	RNA (59-MER)	[U-50% 2H	0.8 ~ 1.0 mM
13	potassium chloride	natural abundance	60 mM
14	calcium Chloride	natural abundance	3 mM
15	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
16	D2O	[U-100% 2H]	100 %

8 2D 1H-1H NOESY

Instrument

Bruker DRX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.15 (±0.15), Details classII_D2O

#	Name	Isotope labeling	Concentration
7	RNA (59-MER)	natural abundance	1.0 ~ 1.2 mM
8	potassium chloride	natural abundance	60 mM
9	calcium chloride	natural abundance	3 mM
10	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
11	D2O	[U-100% 2H]	100 %

9 2D 1H-13C HSQC

Instrument

Bruker DRX - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 300 K, pH 6.15 (±0.15), Details classII_H2O_full

#	Name	Isotope labeling	Concentration
37	RNA (59-MER)	[U-100% 13C; U-100% 15N]	1~1.2 mM
38	potassium chloride	natural abundance	60 mM
39	calcium chloride	natural abundance	3 mM
40	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
41	H2O	natural abundance	90 %
42	D2O	[U-100% 2H]	10 %

10 2D 1H-15N HSQC

Instrument

Bruker DRX - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 300 K, pH 6.15 (±0.15), Details classII_H2O_full

#	Name	Isotope labeling	Concentration
37	RNA (59-MER)	[U-100% 13C; U-100% 15N]	1~1.2 mM
38	potassium chloride	natural abundance	60 mM
39	calcium chloride	natural abundance	3 mM
40	7-DEAZA-7-AMINOMETHYL-GUANINE	natural abundance	2 mM
41	H2O	natural abundance	90 %
42	D2O	[U-100% 2H]	10 %

NMR combined restraints 7 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_19698_2miy.nef
Input source #2: Coordindates	2miy.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Error

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
A	0	.	Not matched with CCD	None
B	1	PRF	7-DEAZA-7-AMINOMETHYL-GUANINE	Assigned chemical shifts

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

----------10--------20--------30--------40--------50--------
.GCUUGGUGCUUAGCUUCUUUCACCAAGCAUAUUACACGCGGAUAACCGCCAAAGGAGAA
 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-GCUUGGUGCUUAGCUUCUUUCACCAAGCAUAUUACACGCGGAUAACCGCCAAAGGAGAA
 ---------10--------20--------30--------40--------50--------

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	59	1	0	100.0

Content subtype: combined_19698_2miy.nef

#	Content subtype	Saveframe	Status	# of rows	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Error	777		100.0 (chain: B, length: 1)
2	Assigned chemical shifts	assigned_chem_shift_list_2	Error	520		No information
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Error	793	noe	No information
2	Distance restraints	CNS/XPLOR_distance_constraints_3	Error	106	hbond	No information
1	Dihedral angle restraints	CNS/XPLOR_dihedral_4	Error	219	.	No information
1	RDC restraints	CNS/XPLOR_dipolar_coupling_7	Error	102	.	No information

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: Error
- Sequence coverage of experimental data
  - Entity_assembly_ID: B, Chain length: 1, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 421
  - ¹³C chemical shifts: 336
  - ¹⁵N chemical shifts: 20
- Completeness of assignments
  - Entity_assemble_ID: B
- Histogram of normalized assigned chemical shifts
Saveframe: assigned_chem_shift_list_2
- Status: Error
- Total number of assignments
  - ¹H chemical shifts: 275
  - ¹³C chemical shifts: 245
- Histogram of normalized assigned chemical shifts

Comp_index_ID	Comp_ID
1	PRF

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Error
- Experiment type: noe
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: Error
  - Experiment type: hbond

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_4
- Status: Error
- Experiment type: .

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_7
- Status: Error
- Experiment type: .

Keywords classII, preQ1, pseudoknot, riboswitch, Streptococcus pneumoniae

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.389 seconds)

BMRB: 19698

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #6

Sample #7

Sample #8

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #6

Sample #7

Sample #8

Related entities 1. RNA (59-MER), : 1 entities Detail

Experiments performed 10 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 7 contents Detail