Structure of CssA4 (bottom stem) of CssA thermometer
Polymer type: polyribonucleotide
Total | 1H | 13C | 15N | |
---|---|---|---|---|
All | 51.2 % (296 of 578) | 64.9 % (203 of 313) | 31.0 % (76 of 245) | 85.0 % (17 of 20) |
Suger, PO4 | 33.6 % (133 of 396) | 50.9 % (110 of 216) | 12.8 % (23 of 180) | |
Nucleobase | 89.6 % (163 of 182) | 95.9 % (93 of 97) | 81.5 % (53 of 65) | 85.0 % (17 of 20) |
Aromatic | 88.8 % (151 of 170) | 95.3 % (81 of 85) | 81.5 % (53 of 65) | 85.0 % (17 of 20) |
1. RNA (36-MER)
GGAAUUUAUG AGUACCUUCG GAUACUUAUA GAUUCCSolvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA4 (36mer) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA4 (36mer) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA4 (36mer) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA4 (36mer) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA4 (36mer) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA4 (36mer) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA4 (36mer) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA4 (36mer) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA4 (36mer) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA4 (36mer) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA4 (36mer) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA4 (36mer) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA4 (36mer) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA4 (36mer) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA4 (36mer) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA4 (36mer) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 600 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA4 (36mer) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA4 (36mer) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA4 (36mer) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA4 (36mer) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 600 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA4 (36mer) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA4 (36mer) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA4 (36mer) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA4 (36mer) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA4 (36mer) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA4 (36mer) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA4 (36mer) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA4 (36mer) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 600 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA4 (36mer) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA4 (36mer) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA4 (36mer) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA4 (36mer) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Agilent INOVA - 900 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA4 (36mer) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA4 (36mer) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA4 (36mer) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA4 (36mer) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Agilent INOVA - 900 MHz
State anisotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA4 (36mer) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA4 (36mer) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA4 (36mer) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA4 (36mer) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints | combined_25780_2n6s.nef |
Input source #2: Coordindates | 2n6s.cif |
Diamagnetism of the molecular assembly | True (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | True (see coodinates for details) |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Warning |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
Ptnr_site_1 | Ptnr_site_2 | Redox_state_prediction_1 | Redox_state_prediction_2 | Distance (Å) |
---|---|---|---|---|
1:1:G:O3' | 1:2:G:P | unknown | unknown | n/a |
Non-standard residues
NoneSequence alignments
--------10--------20--------30------ GGAAUUUAUGAGUACCUUCGGAUACUUAUAGAUUCC |||||||||||||||||||||||||||||||||||| GGAAUUUAUGAGUACCUUCGGAUACUUAUAGAUUCC
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
A | A | 36 | 0 | 0 | 100.0 |
Content subtype: combined_25780_2n6s.nef
Assigned chemical shifts
Comp_index_ID | Comp_ID | Atom_ID | CS value (ppm) |
---|---|---|---|
10 | G | H21 | 5.862 |
12 | G | H21 | 8.32 |
14 | A | H61 | 6.403 |
14 | A | H62 | 7.626 |
17 | U | HO2' | 6.45 |
21 | G | H22 | 7.534 |
21 | G | H21 | 6.17 |
22 | A | H61 | 6.402 |
22 | A | H62 | 9.977 |
31 | G | H22 | 6.125 |
31 | G | H21 | 6.11 |
32 | A | HO2' | 4.374 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 313 | 203 | 64.9 |
13C chemical shifts | 245 | 76 | 31.0 |
15N chemical shifts | 20 | 17 | 85.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 216 | 110 | 50.9 |
13C chemical shifts | 180 | 23 | 12.8 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 97 | 93 | 95.9 |
13C chemical shifts | 65 | 53 | 81.5 |
15N chemical shifts | 20 | 17 | 85.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 27 | 27 | 100.0 |
13C chemical shifts | 27 | 26 | 96.3 |
Covalent bonds
Distance restraints
--------10--------20--------30------ GGAAUUUAUGAGUACCUUCGGAUACUUAUAGAUUCC |||||||||||||||||||||||||||||||||||| GGAAUUUAUGAGUACCUUCGGAUACUUAUAGAUUCC
--------10--------20--------30------ GGAAUUUAUGAGUACCUUCGGAUACUUAUAGAUUCC ||||||||||||||||| ||||||||||||||||| GGAAUUUAUGAGUACCU..GGAUACUUAUAGAUUCC