BMRBj - BMREntryMaster

Found 1 Document (0.403 seconds)

BMRB: 25781

2N6T

NMR Assignment and NMR Structure of CssA3 (top stem) of CssA thermometer

Authors

Barnwal, R.P., Godin, K.S., Varani, G., Loh, E., Yip, J., Tang, C.M.

Assembly

CssA3 (top stem) of CssA thermometer

Entity

1. CssA3 (top stem) of CssA thermometer (polymer, Thiol state: not present), 42 monomers, 13411.82 Da Detail

GGGUAGAGUA UAAUUAGUCU UCGGACUUCC UUAUACUUAU CC

Formula weight

13411.82 Da

Source organism

Neisseria meningitidis

Exptl. method

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 43.7 %, Completeness (bb): 27.5 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	43.7 % (296 of 678)	58.4 % (215 of 368)	23.4 % (67 of 286)	58.3 % (14 of 24)
Suger, PO4	27.5 % (127 of 462)	43.3 % (109 of 252)	8.6 % (18 of 210)
Nucleobase	78.2 % (169 of 216)	91.4 % (106 of 116)	64.5 % (49 of 76)	58.3 % (14 of 24)
Aromatic	79.5 % (159 of 200)	96.0 % (96 of 100)	64.5 % (49 of 76)	58.3 % (14 of 24)

1. CssA3 RNA (42-MER)

GGGUAGAGUA UAAUUAGUCU UCGGACUUCC UUAUACUUAU CC

Show sample condition

Sample

Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA3 RNA (42-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA3 RNA (42-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA3 RNA (42-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA3 RNA (42-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

Release date

2016-07-25

Citation

Structure and mechanism of a molecular rheostat, an RNA thermometer that modulates immune evasion by Neisseria meningitidis
Barnwal, R.P., Loh, E., Godin, K.S., Yip, J., Lavender, H., Tang, C.M., Varani, G.
Nucleic Acids Res. (2016), 44, 9426-9437, PubMed 27369378 , DOI 10.1093/nar/gkw584 , Abstract

Experiments performed 9 experiments Detail

1 2D 1H-15N HSQC

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA3 RNA (42-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA3 RNA (42-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA3 RNA (42-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA3 RNA (42-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

2 2D 1H-13C HSQC

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA3 RNA (42-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA3 RNA (42-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA3 RNA (42-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA3 RNA (42-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

3 2D 1H-1H TOCSY

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA3 RNA (42-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA3 RNA (42-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA3 RNA (42-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA3 RNA (42-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

4 2D 1H-1H NOESY

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA3 RNA (42-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA3 RNA (42-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA3 RNA (42-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA3 RNA (42-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

5 3D HCCH-TOCSY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA3 RNA (42-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA3 RNA (42-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA3 RNA (42-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA3 RNA (42-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

6 3D 1H-13C NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA3 RNA (42-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA3 RNA (42-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA3 RNA (42-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA3 RNA (42-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

7 2D DQF-COSY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA3 RNA (42-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA3 RNA (42-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA3 RNA (42-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA3 RNA (42-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

8 ARTSY

Instrument

Agilent INOVA - 900 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA3 RNA (42-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA3 RNA (42-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA3 RNA (42-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA3 RNA (42-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

9 ARTSY

Instrument

Agilent INOVA - 900 MHz

Sample

State anisotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA3 RNA (42-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA3 RNA (42-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA3 RNA (42-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA3 RNA (42-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, RDC restraints	combined_25781_2n6t.nef
Input source #2: Coordindates	2n6t.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	True (see coodinates for details)
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Ptnr_site_1	Ptnr_site_2	Redox_state_prediction_1	Redox_state_prediction_2	Distance (Å)
1:1:G:O3'	1:2:G:P	unknown	unknown	n/a

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30--------40--
GGGUAGAGUAUAAUUAGUCUUCGGACUUCCUUAUACUUAUCC
||||||||||||||||||||||||||||||||||||||||||
GGGUAGAGUAUAAUUAGUCUUCGGACUUCCUUAUACUUAUCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	42	0	0	100.0

Content subtype: combined_25781_2n6t.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Covalent bonds	assembly	OK	1		No information
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	312		100.0 (chain: A, length: 42)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	OK	475 (1)	noe	100.0 (chain: A, length: 42)
2	Distance restraints	CNS/XPLOR_distance_constraints_6	OK	64 (1)	hbond	66.7 (chain: A, length: 42)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_4	OK	64 (64)	.	83.3 (chain: A, length: 42)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 42, Sequence coverage: 100.0%

--------10--------20--------30--------40--
GGGUAGAGUAUAAUUAGUCUUCGGACUUCCUUAUACUUAUCC
||||||||||||||||||||||||||||||||||||||||||
GGGUAGAGUAUAAUUAGUCUUCGGACUUCCUUAUACUUAUCC

Total number of assignments
- ¹H chemical shifts: 231
- ¹⁵N chemical shifts: 14
- ¹³C chemical shifts: 67

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
10	A	H61	6.317
10	A	H62	7.64
12	A	H61	6.228
12	A	H62	7.635
17	G	H22	8.574
17	G	H21	6.272
20	U	HO2'	6.547
23	G	H21	6.248
24	G	H22	8.048
24	G	H21	6.216
25	A	H61	6.516
25	A	H62	8.226
33	A	H61	6.377
33	A	H62	7.541
35	A	H61	6.217
35	A	H62	7.752

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	368	215	58.4
¹⁵N chemical shifts	24	14	58.3
¹³C chemical shifts	286	67	23.4

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	252	109	43.3
¹³C chemical shifts	210	18	8.6

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	116	106	91.4
¹⁵N chemical shifts	24	14	58.3
¹³C chemical shifts	76	49	64.5

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	28	28	100.0
¹³C chemical shifts	28	20	71.4

Histogram of normalized assigned chemical shifts

Covalent bonds

Saveframe: assembly
- Status: OK

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 42, Sequence coverage: 100.0%
- Total number of restraints: 475
- Weight of restraints: 1.0 (475)
- Potential type of restraints: square-well-parabolic (475)
- Range of distance target values: 2.2, 6.0 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_6
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 42, Sequence coverage: 66.7%
  - Total number of restraints: 64
  - Weight of restraints: 1.0 (64)
  - Potential type of restraints: square-well-parabolic (64)
  - Range of distance target values: 1.9, 2.8 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_4
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 42, Sequence coverage: 83.3%
- Total number of restraints: 64
- Potential type of restraints: undefined (64)
- Range of observed RDC values: 100.0, -100.0 (Hz)
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords NMR, Neisseria meningitidis, RNA regulation, RNA thermometer, pathogen