NMR Assignment and structure of CssA Thermometer from Neisseria meningitidis
Polymer type: polyribonucleotide
Total | 1H | 13C | 15N | |
---|---|---|---|---|
All | 30.9 % (338 of 1094) | 47.5 % (281 of 591) | 6.7 % (31 of 465) | 68.4 % (26 of 38) |
Suger, PO4 | 18.2 % (136 of 748) | 33.3 % (136 of 408) | 0.0 % (0 of 340) | |
Nucleobase | 58.4 % (202 of 346) | 79.2 % (145 of 183) | 24.8 % (31 of 125) | 68.4 % (26 of 38) |
Aromatic | 60.7 % (198 of 326) | 86.5 % (141 of 163) | 24.8 % (31 of 125) | 68.4 % (26 of 38) |
1. CssA RNA thermometer (68-MER)
GGAAUUUAUG AGUACGUAGA GUAUAAUUAG UCUUCGGACU UCCUUAUACU UAUAUACUUA UAGAUUCCSolvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA RNA thermometer (68-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA RNA thermometer (68-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA RNA thermometer (68-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA RNA thermometer (68-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 600 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA RNA thermometer (68-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA RNA thermometer (68-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA RNA thermometer (68-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA RNA thermometer (68-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 600 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA RNA thermometer (68-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA RNA thermometer (68-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA RNA thermometer (68-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA RNA thermometer (68-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA RNA thermometer (68-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA RNA thermometer (68-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA RNA thermometer (68-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA RNA thermometer (68-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA RNA thermometer (68-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA RNA thermometer (68-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA RNA thermometer (68-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA RNA thermometer (68-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 600 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA RNA thermometer (68-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA RNA thermometer (68-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA RNA thermometer (68-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA RNA thermometer (68-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 600 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA RNA thermometer (68-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA RNA thermometer (68-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA RNA thermometer (68-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA RNA thermometer (68-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA RNA thermometer (68-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA RNA thermometer (68-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA RNA thermometer (68-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA RNA thermometer (68-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Agilent INOVA - 900 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA RNA thermometer (68-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA RNA thermometer (68-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA RNA thermometer (68-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA RNA thermometer (68-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Agilent INOVA - 900 MHz
State anisotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA RNA thermometer (68-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA RNA thermometer (68-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA RNA thermometer (68-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA RNA thermometer (68-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints | combined_25784_2n6w.nef |
Input source #2: Coordindates | 2n6w.cif |
Diamagnetism of the molecular assembly | True (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | True (see coodinates for details) |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Warning |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
Ptnr_site_1 | Ptnr_site_2 | Redox_state_prediction_1 | Redox_state_prediction_2 | Distance (Å) |
---|---|---|---|---|
1:1:G:O3' | 1:2:G:P | unknown | unknown | n/a |
Non-standard residues
NoneSequence alignments
--------10--------20--------30--------40--------50--------60-------- GGAAUUUAUGAGUACGUAGAGUAUAAUUAGUCUUCGGACUUCCUUAUACUUAUAUACUUAUAGAUUCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGAAUUUAUGAGUACGUAGAGUAUAAUUAGUCUUCGGACUUCCUUAUACUUAUAUACUUAUAGAUUCC
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
A | A | 68 | 0 | 0 | 100.0 |
Content subtype: combined_25784_2n6w.nef
Assigned chemical shifts
--------10--------20--------30--------40--------50--------60-------- GGAAUUUAUGAGUACGUAGAGUAUAAUUAGUCUUCGGACUUCCUUAUACUUAUAUACUUAUAGAUUCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGAAUUUAUGAGUACGUAGAGUAUAAUUAGUCUUCGGACUUCCUUAUACUUAUAUACUUAUAGAUUCC
Comp_index_ID | Comp_ID | Atom_ID | CS value (ppm) |
---|---|---|---|
1 | G | HO2' | 4.866 |
10 | G | H21 | 5.922 |
25 | A | H61 | 6.552 |
25 | A | H62 | 7.637 |
30 | G | H21 | 8.574 |
63 | G | H21 | 6.178 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 591 | 281 | 47.5 |
15N chemical shifts | 38 | 26 | 68.4 |
13C chemical shifts | 465 | 31 | 6.7 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 408 | 136 | 33.3 |
13C chemical shifts | 340 | 0 | 0.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 183 | 145 | 79.2 |
15N chemical shifts | 38 | 26 | 68.4 |
13C chemical shifts | 125 | 31 | 24.8 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 51 | 50 | 98.0 |
13C chemical shifts | 51 | 14 | 27.5 |
Covalent bonds
Distance restraints
--------10--------20--------30--------40--------50--------60-------- GGAAUUUAUGAGUACGUAGAGUAUAAUUAGUCUUCGGACUUCCUUAUACUUAUAUACUUAUAGAUUCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGAAUUUAUGAGUACGUAGAGUAUAAUUAGUCUUCGGACUUCCUUAUACUUAUAUACUUAUAGAUUCC
--------10--------20--------30--------40--------50--------60-------- GGAAUUUAUGAGUACGUAGAGUAUAAUUAGUCUUCGGACUUCCUUAUACUUAUAUACUUAUAGAUUCC |||||||||||||| ||||| |||||| |||||| ||||| |||||||||||||| GGAAUUUAUGAGUA......GUAUA..UAGUCU..GGACUU...UAUAC.....UACUUAUAGAUUCC