NMR Assignment and structure of CssA5 (middle region) of CssA thermometer from Neisseria meningitidis
Polymer type: polyribonucleotide
Total | 1H | 13C | 15N | |
---|---|---|---|---|
All | 36.3 % (250 of 689) | 53.6 % (200 of 373) | 11.0 % (32 of 292) | 75.0 % (18 of 24) |
Suger, PO4 | 19.7 % (93 of 473) | 36.0 % (93 of 258) | 0.0 % (0 of 215) | |
Nucleobase | 72.7 % (157 of 216) | 93.0 % (107 of 115) | 41.6 % (32 of 77) | 75.0 % (18 of 24) |
Aromatic | 71.8 % (145 of 202) | 94.1 % (95 of 101) | 41.6 % (32 of 77) | 75.0 % (18 of 24) |
1. CssA5 RNA (43-MER)
GGUGAGUACG UAGAGUAUAC UUCGGUAUAC UUAUAUACUU ACCSolvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA5 RNA (43-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA5 RNA (43-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA5 RNA (43-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA5 RNA (43-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA5 RNA (43-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA5 RNA (43-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA5 RNA (43-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA5 RNA (43-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA5 RNA (43-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA5 RNA (43-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA5 RNA (43-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA5 RNA (43-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA5 RNA (43-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA5 RNA (43-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA5 RNA (43-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA5 RNA (43-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA5 RNA (43-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA5 RNA (43-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA5 RNA (43-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA5 RNA (43-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA5 RNA (43-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA5 RNA (43-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA5 RNA (43-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA5 RNA (43-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA5 RNA (43-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA5 RNA (43-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA5 RNA (43-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA5 RNA (43-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Bruker Avance - 800 MHz
State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | CssA5 RNA (43-MER) | natural abundance | 0.4 ~ 1.1 mM | |
2 | CssA5 RNA (43-MER) | 13C/15N-uniformly labeled | 0.4 ~ 1.1 mM | |
3 | CssA5 RNA (43-MER) | 13C/15N-AU labeled | 0.4 ~ 1.1 mM | |
4 | CssA5 RNA (43-MER) | partially deuterated | 0.4 ~ 1.1 mM | |
5 | H2O | natural abundance | 95 % | |
6 | D2O | natural abundance | 5 % |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints | combined_25785_2n6x.nef |
Input source #2: Coordindates | 2n6x.cif |
Diamagnetism of the molecular assembly | True (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | True (see coodinates for details) |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Warning |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
Ptnr_site_1 | Ptnr_site_2 | Redox_state_prediction_1 | Redox_state_prediction_2 | Distance (Å) |
---|---|---|---|---|
1:1:G:O3' | 1:2:G:P | unknown | unknown | n/a |
Non-standard residues
NoneSequence alignments
--------10--------20--------30--------40--- GGUGAGUACGUAGAGUAUACUUCGGUAUACUUAUAUACUUACC ||||||||||||||||||||||||||||||||||||||||||| GGUGAGUACGUAGAGUAUACUUCGGUAUACUUAUAUACUUACC
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
A | A | 43 | 0 | 0 | 100.0 |
Content subtype: combined_25785_2n6x.nef
Assigned chemical shifts
Comp_index_ID | Comp_ID | Atom_ID | CS value (ppm) |
---|---|---|---|
1 | G | HO2' | 4.887 |
21 | U | HO2' | 6.642 |
24 | G | H21 | 6.114 |
25 | G | H21 | 8.614 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 373 | 200 | 53.6 |
13C chemical shifts | 292 | 32 | 11.0 |
15N chemical shifts | 24 | 18 | 75.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 258 | 93 | 36.0 |
13C chemical shifts | 215 | 0 | 0.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 115 | 107 | 93.0 |
13C chemical shifts | 77 | 32 | 41.6 |
15N chemical shifts | 24 | 18 | 75.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 33 | 33 | 100.0 |
13C chemical shifts | 33 | 22 | 66.7 |
Covalent bonds
Distance restraints
--------10--------20--------30--------40--- GGUGAGUACGUAGAGUAUACUUCGGUAUACUUAUAUACUUACC ||||||||||||||||||||||||||||||||||||||||||| GGUGAGUACGUAGAGUAUACUUCGGUAUACUUAUAUACUUACC
--------10--------20--------30--------40--- GGUGAGUACGUAGAGUAUACUUCGGUAUACUUAUAUACUUACC |||||||| |||||||| |||||||| |||||||| GGUGAGUA.....AGUAUACU..GGUAUACU....UACUUACC
Dihedral angle restraints
--------10--------20--------30--------40--- GGUGAGUACGUAGAGUAUACUUCGGUAUACUUAUAUACUUACC ||||||||||||||||||||||||||||||||||||||||||| GGUGAGUACGUAGAGUAUACUUCGGUAUACUUAUAUACUUACC