The structure of the SOLE element of oskar mRNA
Polymer type: polyribonucleotide
Total | 1H | 13C | 15N | 31P | |
---|---|---|---|---|---|
All | 93.1 % (501 of 538) | 91.3 % (251 of 275) | 98.6 % (213 of 216) | 46.7 % (7 of 15) | 93.8 % (30 of 32) |
Suger, PO4 | 97.4 % (374 of 384) | 97.4 % (187 of 192) | 98.1 % (157 of 160) | 93.8 % (30 of 32) | |
Nucleobase | 82.5 % (127 of 154) | 77.1 % (64 of 83) | 100.0 % (56 of 56) | 46.7 % (7 of 15) | |
Aromatic | 89.4 % (127 of 142) | 90.1 % (64 of 71) | 100.0 % (56 of 56) | 46.7 % (7 of 15) |
1. OSKAR MRNA
GACGAUAUCG AGCAUCAAGA GUGAAUAUCG UCSolvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | OSKAR MRNA | [U-13C; U-15N] | 0.35 (±0.05) mM |
Bruker Avance - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | OSKAR MRNA | [U-13C; U-15N] | 0.35 (±0.05) mM |
Bruker Avance - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | OSKAR MRNA | [U-13C; U-15N] | 0.35 (±0.05) mM |
Bruker Avance - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | OSKAR MRNA | [U-13C; U-15N] | 0.35 (±0.05) mM |
Bruker Avance - 800 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | OSKAR MRNA | [U-13C; U-15N] | 0.35 (±0.05) mM |
Bruker Avance - 800 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | OSKAR MRNA | [U-13C; U-15N] | 0.35 (±0.05) mM |
Bruker Avance - 800 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | OSKAR MRNA | [U-13C; U-15N] | 0.35 (±0.05) mM |
Bruker Avance - 800 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | OSKAR MRNA | [U-13C; U-15N] | 0.35 (±0.05) mM |
Bruker Avance - 800 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | OSKAR MRNA | [U-13C; U-15N] | 0.35 (±0.05) mM |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints | combined_26568_5a17.nef |
Input source #2: Coordindates | 5a17.cif |
Diamagnetism of the molecular assembly | True (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | None |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Warning |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
NoneNon-standard residues
NoneSequence alignments
--------10--------20--------30-- GACGAUAUCGAGCAUCAAGAGUGAAUAUCGUC |||||||||||||||||||||||||||||||| GACGAUAUCGAGCAUCAAGAGUGAAUAUCGUC
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
A | A | 32 | 0 | 0 | 100.0 |
Content subtype: combined_26568_5a17.nef
Assigned chemical shifts
Comp_index_ID | Comp_ID | Atom_ID | CS value (ppm) |
---|---|---|---|
1 | G | N9 | 167.6 |
1 | G | P | -3.78 |
2 | A | N9 | 170.7 |
2 | A | P | -3.94 |
3 | C | N1 | 150.0 |
3 | C | P | -4.33 |
4 | G | N9 | 168.7 |
4 | G | P | -4.46 |
5 | A | N9 | 170.5 |
6 | U | N1 | 145.5 |
6 | U | P | -1.08 |
7 | A | N9 | 170.7 |
7 | A | P | -4.25 |
8 | U | N1 | 145.3 |
8 | U | P | -4.63 |
9 | C | N1 | 150.4 |
9 | C | P | -4.45 |
10 | G | N9 | 168.7 |
10 | G | P | -4.13 |
11 | A | N9 | 169.1 |
11 | A | P | -4.09 |
12 | G | N9 | 168.7 |
12 | G | P | -4.08 |
13 | C | P | -4.23 |
14 | A | N9 | 169.1 |
14 | A | P | -4.08 |
15 | U | N1 | 143.6 |
15 | U | P | -4.33 |
16 | C | N1 | 150.6 |
16 | C | P | -4.25 |
17 | A | N9 | 168.3 |
17 | A | P | -4.08 |
18 | A | N9 | 168.3 |
18 | A | P | -3.85 |
19 | G | N9 | 167.9 |
19 | G | P | -4.06 |
20 | A | N9 | 168.5 |
20 | A | P | -4.06 |
21 | G | N9 | 168.7 |
21 | G | P | -0.66 |
22 | U | N1 | 146.1 |
23 | G | N9 | 167.3 |
23 | G | P | -4.25 |
24 | A | N9 | 168.3 |
24 | A | P | -4.14 |
25 | A | N9 | 169.1 |
25 | A | P | -4.48 |
26 | U | N1 | 145.5 |
26 | U | P | -4.25 |
27 | A | N9 | 170.8 |
27 | A | P | -4.48 |
28 | U | N1 | 146.1 |
28 | U | P | -4.63 |
29 | C | N1 | 150.3 |
29 | C | P | -4.08 |
30 | G | N9 | 168.3 |
30 | G | P | -4.25 |
31 | U | N1 | 146.4 |
31 | U | P | -4.98 |
32 | C | N1 | 150.0 |
32 | C | P | -4.56 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 275 | 251 | 91.3 |
13C chemical shifts | 216 | 213 | 98.6 |
15N chemical shifts | 15 | 7 | 46.7 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 192 | 187 | 97.4 |
13C chemical shifts | 160 | 157 | 98.1 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 83 | 64 | 77.1 |
13C chemical shifts | 56 | 56 | 100.0 |
15N chemical shifts | 15 | 7 | 46.7 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 30 | 30 | 100.0 |
13C chemical shifts | 30 | 30 | 100.0 |
Distance restraints
Dihedral angle restraints
--------10--------20--------30-- GACGAUAUCGAGCAUCAAGAGUGAAUAUCGUC ||||||||||||||||| ||||| |||||||| GACGAUAUCGAGCAUCA.GAGUG.AUAUCGUC
RDC restraints
--------10--------20--------30-- GACGAUAUCGAGCAUCAAGAGUGAAUAUCGUC |||||||||||||||||||||||||||||||| GACGAUAUCGAGCAUCAAGAGUGAAUAUCGUC