NMR structure of the 5'-terminal hairpin of the 7SK snRNA
Polymer type: polyribonucleotide
Total | 1H | 13C | 15N | |
---|---|---|---|---|
All | 37.8 % (347 of 919) | 50.6 % (256 of 506) | 17.9 % (68 of 380) | 69.7 % (23 of 33) |
Suger, PO4 | 19.6 % (123 of 627) | 30.4 % (104 of 342) | 6.7 % (19 of 285) | |
Nucleobase | 76.7 % (224 of 292) | 92.7 % (152 of 164) | 51.6 % (49 of 95) | 69.7 % (23 of 33) |
Aromatic | 76.6 % (196 of 256) | 96.9 % (124 of 128) | 51.6 % (49 of 95) | 69.7 % (23 of 33) |
1. RNA (57-MER)
GGGAUCUGUC ACCCCAUUGA UCGCCUUCGG GCUGAUCUGG CUGGCUAGGC GGGUCCCSolvent system 90% H2O/10% D2O, Pressure 101325 Pa, Temperature 303 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | HPI | natural abundance | 0.8 mM | |
2 | HPI | [U-99% 13C; U-99% 15N] | 0.4 mM | |
3 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
4 | HPI | [U-13C; U-15N]-Cyt | 0.4 mM | |
5 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
6 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
7 | H2O | natural abundance | 90 % | |
8 | D2O | natural abundance | 10 % |
Solvent system 100% D2O, Pressure 101325 Pa, Temperature 303 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | HPI | natural abundance | 0.8 mM | |
10 | HPI | [U-99% 13C; U-99% 15N] | 0.4 mM | |
11 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
12 | HPI | [U-13C; U-15N]-Cyt | 0.4 mM | |
13 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
14 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
15 | D2O | natural abundance | 100 % |
Solvent system 90% H2O/10% D2O, Pressure 101325 Pa, Temperature 303 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
16 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
17 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
18 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
19 | H2O | natural abundance | 90 % | |
20 | D2O | natural abundance | 10 % |
Bruker AvanceIII - 700 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 101325 Pa, Temperature 288 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | HPI | natural abundance | 0.8 mM | |
2 | HPI | [U-99% 13C; U-99% 15N] | 0.4 mM | |
3 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
4 | HPI | [U-13C; U-15N]-Cyt | 0.4 mM | |
5 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
6 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
7 | H2O | natural abundance | 90 % | |
8 | D2O | natural abundance | 10 % |
Bruker AvanceIII - 700 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 101325 Pa, Temperature 288 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | HPI | natural abundance | 0.8 mM | |
2 | HPI | [U-99% 13C; U-99% 15N] | 0.4 mM | |
3 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
4 | HPI | [U-13C; U-15N]-Cyt | 0.4 mM | |
5 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
6 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
7 | H2O | natural abundance | 90 % | |
8 | D2O | natural abundance | 10 % |
Bruker AvanceIII - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 101325 Pa, Temperature 303 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | HPI | natural abundance | 0.8 mM | |
10 | HPI | [U-99% 13C; U-99% 15N] | 0.4 mM | |
11 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
12 | HPI | [U-13C; U-15N]-Cyt | 0.4 mM | |
13 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
14 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
15 | D2O | natural abundance | 100 % |
Bruker AvanceIII - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 101325 Pa, Temperature 303 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | HPI | natural abundance | 0.8 mM | |
10 | HPI | [U-99% 13C; U-99% 15N] | 0.4 mM | |
11 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
12 | HPI | [U-13C; U-15N]-Cyt | 0.4 mM | |
13 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
14 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
15 | D2O | natural abundance | 100 % |
Bruker AvanceIII - 700 MHz
State anisotropic, Solvent system 90% H2O/10% D2O, Pressure 101325 Pa, Temperature 303 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
16 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
17 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
18 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
19 | H2O | natural abundance | 90 % | |
20 | D2O | natural abundance | 10 % |
Bruker DRX - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 101325 Pa, Temperature 303 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | HPI | natural abundance | 0.8 mM | |
10 | HPI | [U-99% 13C; U-99% 15N] | 0.4 mM | |
11 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
12 | HPI | [U-13C; U-15N]-Cyt | 0.4 mM | |
13 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
14 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
15 | D2O | natural abundance | 100 % |
Bruker AvanceIII - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 101325 Pa, Temperature 303 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | HPI | natural abundance | 0.8 mM | |
10 | HPI | [U-99% 13C; U-99% 15N] | 0.4 mM | |
11 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
12 | HPI | [U-13C; U-15N]-Cyt | 0.4 mM | |
13 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
14 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
15 | D2O | natural abundance | 100 % |
Bruker AvanceIII - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 101325 Pa, Temperature 303 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | HPI | natural abundance | 0.8 mM | |
10 | HPI | [U-99% 13C; U-99% 15N] | 0.4 mM | |
11 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
12 | HPI | [U-13C; U-15N]-Cyt | 0.4 mM | |
13 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
14 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
15 | D2O | natural abundance | 100 % |
Bruker AvanceIII - 700 MHz
State anisotropic, Solvent system 90% H2O/10% D2O, Pressure 101325 Pa, Temperature 303 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
16 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
17 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
18 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
19 | H2O | natural abundance | 90 % | |
20 | D2O | natural abundance | 10 % |
Bruker AvanceIII - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 101325 Pa, Temperature 303 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | HPI | natural abundance | 0.8 mM | |
10 | HPI | [U-99% 13C; U-99% 15N] | 0.4 mM | |
11 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
12 | HPI | [U-13C; U-15N]-Cyt | 0.4 mM | |
13 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
14 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
15 | D2O | natural abundance | 100 % |
Bruker AvanceIII - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 101325 Pa, Temperature 303 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | HPI | natural abundance | 0.8 mM | |
10 | HPI | [U-99% 13C; U-99% 15N] | 0.4 mM | |
11 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
12 | HPI | [U-13C; U-15N]-Cyt | 0.4 mM | |
13 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
14 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
15 | D2O | natural abundance | 100 % |
Bruker AvanceIII - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 101325 Pa, Temperature 303 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | HPI | natural abundance | 0.8 mM | |
10 | HPI | [U-99% 13C; U-99% 15N] | 0.4 mM | |
11 | HPI | [U-13C; U-15N]-Ade | 0.4 mM | |
12 | HPI | [U-13C; U-15N]-Cyt | 0.4 mM | |
13 | HPI | [U-13C; U-15N]-Gua | 0.4 mM | |
14 | HPI | [U-13C; U-15N]-Ura | 0.4 mM | |
15 | D2O | natural abundance | 100 % |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints | combined_30026_5iem.nef |
Input source #2: Coordindates | 5iem.cif |
Diamagnetism of the molecular assembly | True (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | None |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Warning |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
NoneNon-standard residues
NoneSequence alignments
--------10--------20--------30--------40--------50------- GGGAUCUGUCACCCCAUUGAUCGCCUUCGGGCUGAUCUGGCUGGCUAGGCGGGUCCC ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGGAUCUGUCACCCCAUUGAUCGCCUUCGGGCUGAUCUGGCUGGCUAGGCGGGUCCC
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
A | A | 57 | 0 | 0 | 100.0 |
Content subtype: combined_30026_5iem.nef
Assigned chemical shifts
--------10--------20--------30--------40--------50------- GGGAUCUGUCACCCCAUUGAUCGCCUUCGGGCUGAUCUGGCUGGCUAGGCGGGUCCC ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGGAUCUGUCACCCCAUUGAUCGCCUUCGGGCUGAUCUGGCUGGCUAGGCGGGUCCC
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 506 | 256 | 50.6 |
13C chemical shifts | 380 | 68 | 17.9 |
15N chemical shifts | 33 | 23 | 69.7 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 342 | 104 | 30.4 |
13C chemical shifts | 285 | 19 | 6.7 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 164 | 152 | 92.7 |
13C chemical shifts | 95 | 49 | 51.6 |
15N chemical shifts | 33 | 23 | 69.7 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 31 | 31 | 100.0 |
13C chemical shifts | 31 | 31 | 100.0 |
Distance restraints
--------10--------20--------30--------40--------50------- GGGAUCUGUCACCCCAUUGAUCGCCUUCGGGCUGAUCUGGCUGGCUAGGCGGGUCCC ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGGAUCUGUCACCCCAUUGAUCGCCUUCGGGCUGAUCUGGCUGGCUAGGCGGGUCCC
--------10--------20--------30--------40--------50------- GGGAUCUGUCACCCCAUUGAUCGCCUUCGGGCUGAUCUGGCUGGCUAGGCGGGUCCC |||||||||| |||| |||||||| |||| |||| || || |||||||||| GGGAUCUGUC.CCCC...GAUCGCCU..GGGC.GAUC.GG..GG...GGCGGGUCCC
Dihedral angle restraints
--------10--------20--------30--------40--------50------- GGGAUCUGUCACCCCAUUGAUCGCCUUCGGGCUGAUCUGGCUGGCUAGGCGGGUCCC ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGGAUCUGUCACCCCAUUGAUCGCCUUCGGGCUGAUCUGGCUGGCUAGGCGGGUCCC
RDC restraints