BMRBj - BMREntryMaster

Found 1 Document (0.351 seconds)

BMRB: 30552

6NEB

MYC Promoter G-Quadruplex with 1:6:1 loop length

Authors

Dickerhoff, J., Onel, B., Chen, L., Chen, Y., Yang, D.

Assembly

DNA (27-MER)

Entity

1. DNA (27-MER) (polymer, Thiol state: not present), 27 monomers, 8626.471 Da Detail

TTGGGGAGGG TTTTAAGGGT GGGGAAT

Formula weight

8626.471 Da

Source organism

Homo sapiens

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 95.2 %, Completeness (bb): 98.9 % Detail

Polymer type: polydeoxyribonucleotide

	Total	¹H
All	95.2 % (239 of 251)	95.2 % (239 of 251)
Suger, PO4	98.9 % (187 of 189)	98.9 % (187 of 189)
Nucleobase	83.9 % (52 of 62)	83.9 % (52 of 62)
Aromatic	81.5 % (44 of 54)	81.5 % (44 of 54)
Methyl	100.0 % (8 of 8)	100.0 % (8 of 8)

1. entity 1

TTGGGGAGGG TTTTAAGGGT GGGGAAT

Show sample condition

Sample

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7, Details 1.5 mM DNA (27-MER), 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
1	DNA (27-MER)	natural abundance	1.5 mM
2	potassium phosphate	natural abundance	25 mM
3	potassium chloride	natural abundance	75 mM

Release date

2019-02-05

Citation

Solution Structure of a MYC Promoter G-Quadruplex with 1:6:1 Loop Length
Dickerhoff, J., Onel, B., Chen, L., Chen, Y., Yang, D.
ACS Omega (2019), 4, 2533-2539, PubMed 30842981 , DOI 10.1021/acsomega.8b03580 , Abstract

Experiments performed 5 experiments Detail

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_30552_6neb.nef
Input source #2: Coordindates	6neb.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

0--------10--------20------
TTGGGGAGGGTTTTAAGGGTGGGGAAT
|||||||||||||||||||||||||||
TTGGGGAGGGTTTTAAGGGTGGGGAAT
--------10--------20-------

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	27	0	0	100.0

Content subtype: combined_30552_6neb.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	OK	276		100.0 (chain: A, length: 27)
1	Distance restraints	CNS/XPLOR_distance_constraints_7	OK	603 (1)	noe	100.0 (chain: A, length: 27)
2	Distance restraints	CNS/XPLOR_distance_constraints_2	OK	56 (1)	hbond	59.3 (chain: A, length: 27)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_5	OK	27 (27)	.	100.0 (chain: A, length: 27)

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: OK

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 100.0%

0--------10--------20------
TTGGGGAGGGTTTTAAGGGTGGGGAAT
|||||||||||||||||||||||||||
TTGGGGAGGGTTTTAAGGGTGGGGAAT

Total number of assignments
- ¹H chemical shifts: 244
- ¹³C chemical shifts: 32

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
0	DT	C6	139.802
1	DT	C6	139.581
2	DG	C8	140.112
3	DG	C8	138.711
4	DG	H21	9.199
4	DG	H22	6.809
4	DG	C8	137.846
5	DG	C8	138.081
6	DA	C2	155.93
6	DA	C8	142.842
7	DG	C8	138.444
8	DG	H21	9.358
8	DG	C8	138.851
9	DG	C8	138.399
10	DT	C6	140.33
11	DT	C6	140.223
12	DT	C6	140.294
13	DT	C6	139.982
14	DA	C2	155.768
14	DA	C8	142.829
15	DA	C2	154.862
15	DA	C8	143.324
16	DG	C8	139.342
17	DG	H21	9.326
17	DG	H22	6.867
17	DG	C8	137.976
18	DG	C8	138.412
19	DT	C6	140.25
20	DG	C8	138.407
21	DG	C8	138.769
22	DG	C8	137.092
23	DG	C8	138.637
24	DA	C2	155.124
24	DA	C8	141.965
25	DA	C2	155.185
25	DA	C8	141.459
26	DT	C6	139.595

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	251	239	95.2

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	189	187	98.9

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	62	52	83.9

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	8	8	100.0
¹³C chemical shifts	8	0	0.0

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	24	24	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_7
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 100.0%
- Total number of restraints: 603
- Weight of restraints: 1.0 (603)
- Potential type of restraints: square-well-parabolic (603)
- Range of distance target values: 2.9, 6.0 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_2
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 59.3%
  - Total number of restraints: 56
  - Weight of restraints: 1.0 (56)
  - Potential type of restraints: square-well-parabolic (56)
  - Range of distance target values: 1.95, 2.95 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_5
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 100.0%
- Total number of restraints: 27
- Total number of restraints per polymer type: 27
- Weight of restraints: 1.0 (27)
- Potential type of restraints: square-well-parabolic (27)
- Dihedral angle restraints per residue
  - Chain_ID: A

Keywords DNA, G-quadruplex, MYC, Promoter

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.351 seconds)

BMRB: 30552

Sample

Experiments performed 5 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 5 contents Detail