BMRBj - BMREntryMaster

Found 1 Document (0.462 seconds)

BMRB: 31009

7UMD

DENV1 SLA three-way junction RNA (DenvSLAsh)

Authors

Sun, Y.T., Varani, G., Seattle Structural Genomics Center for Infectious Disease (SSGCID)

Assembly

RNA (40-MER)

Entity

1. RNA (40-MER) (polymer, Thiol state: not present), 40 monomers, 12992.72 Da Detail

GGACGUGGAC CGACUUCGGU CGGAAGGAAA CUUAACGUCC

Formula weight

12992.72 Da

Source organism

dengue virus type I

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 97.5 %, Completeness: 47.8 %, Completeness (bb): 32.9 % Detail

Polymer type: polyribonucleotide

	Total	¹H
All	47.8 % (166 of 347)	47.8 % (166 of 347)
Suger, PO4	32.9 % (79 of 240)	32.9 % (79 of 240)
Nucleobase	81.3 % (87 of 107)	81.3 % (87 of 107)
Aromatic	81.6 % (71 of 87)	81.6 % (71 of 87)

1. entity 1

GGACGUGGAC CGACUUCGGU CGGAAGGAAA CUUAACGUCC

Show sample condition

Sample #1

Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 298 K, pH 6.5, Details 1 mM RNA (40-MER), 10 mM potassium phosphate, 95% H2O/5% D2O

#	Name	Isotope labeling	Type	Concentration
1	RNA (40-MER)	natural abundance		1 mM
2	potassium phosphate	natural abundance		10 mM

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.5, Details 1 mM RNA (40-MER), 10 mM potassium phosphate, 100% D2O

#	Name	Isotope labeling	Type	Concentration
3	RNA (40-MER)	natural abundance		1 mM
4	potassium phosphate	natural abundance		10 mM

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.5, Details 1 mM [U-2H] RNA (40-MER), 10 mM potassium phosphate, 100% D2O

#	Name	Isotope labeling	Type	Concentration
5	RNA (40-MER)	[U-2H]		1 mM
6	potassium phosphate	natural abundance		10 mM

Release date

2022-05-08

Citation

Structure of the Dengue Virus RNA Promoter
Sun, Y.T., Varani, G.
RNA (2022), 28, 1210-1223, PubMed 35750488 , DOI 10.1261/rna.079197.122 , Abstract

Entries sharing articles BMRB: 2 entries Detail

  BMRB: 31008 released on 2022-05-02
    Title DENV1 SLA RNA (DenvSLATL)
  BMRB: 30853 released on 2021-02-13
    Title Denv1 5'UTR Stem3

Related entities 1. RNA (40-MER), : 1 : 1 entities Detail

Experiments performed 6 experiments Detail

Chemical shift validation 3 contents Detail

Properties

Input source #1: Assigned chemical shifts - Assigned chemical shifts	bmr31009_3.str
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Content subtype: bmr31009_3.str

#	Content subtype	Saveframe	Status	# of rows	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	206		97.5 (chain: 1, length: 40)
1	Chemical shift references	chem_shift_reference_1	OK	1		No information

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: 1, Chain length: 40, Sequence coverage: 97.5%

--------10--------20--------30--------40
GGACGUGGACCGACUUCGGUCGGAAGGAAACUUAACGUCC
||||||||||||||||||||||||||||||||||||||| 
GGACGUGGACCGACUUCGGUCGGAAGGAAACUUAACGUC 
--------10--------20--------30---------

Total number of assignments
- ¹H chemical shifts: 206

Completeness of assignments

Entity_assemble_ID: 1

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	HO2'	4.825
2	G	HO2'	4.558
3	A	HO2'	4.478
4	C	HO2'	4.321
5	G	HO2'	4.324
6	U	HO2'	4.309
7	G	HO2'	4.367
8	G	HO2'	4.397
9	A	HO2'	4.598
10	C	HO2'	4.287
11	C	HO2'	4.448
12	G	HO2'	4.457
13	A	HO2'	4.469
14	C	HO2'	4.24
15	U	HO2'	3.652
16	U	HO2'	4.542
17	C	HO2'	3.977
18	G	H21	7.759
18	G	H22	6.396
18	G	HO2'	4.7
19	G	HO2'	4.31
20	U	HO2'	4.425
21	C	HO2'	4.455
22	G	HO2'	4.508
23	G	HO2'	4.474
24	A	HO2'	4.45
25	A	HO2'	4.179
27	G	HO2'	4.596
28	A	HO2'	4.364
29	A	HO2'	4.38
30	A	HO2'	4.134
31	C	HO2'	4.132
32	U	HO2'	4.137
33	U	HO2'	4.236
34	A	HO2'	4.725
35	A	HO2'	4.459
36	C	HO2'	4.384
37	G	HO2'	4.392
38	U	HO2'	4.386
39	C	HO2'	4.438

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	347	166	47.8

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	240	79	32.9

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	107	87	81.3

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	33	26	78.8

Histogram of normalized assigned chemical shifts

Keywords 5' UTR, NS5 promoter, RNA, SLA, flavivirus, viral replication

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.462 seconds)

BMRB: 31009

Sample #1

Sample #2

Sample #3

Entries sharing articles BMRB: 2 entries Detail

Related entities 1. RNA (40-MER), : 1 : 1 entities Detail

Experiments performed 6 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Chemical shift validation 3 contents Detail