BMRBj - BMREntryMaster

Found 1 Document (0.249 seconds)

BMRB: 34441

NMR structure of KRAS32R G25T conformer G-quadruplex within KRAS promoter region

Authors

Marquevielle, J., Salgado, G.

Assembly

KRAS32R G25T

Entity

1. KRAS32R G25T, entity 1 (polymer, Thiol state: not present), 32 monomers, 10309.54 Da Detail

AGGGCGGTGT GGGAAGAGGG AAGATGGGGA GG

2. KRAS32R G25T, entity K (non-polymer), 39.098 × 2 Da

Total weight

10387.736 Da

Max. entity weight

10309.54 Da

Source organism

Homo sapiens

Exptl. method

solution NMR

Data set

assigned_chemical_shifts, spectral_peak_list

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 86.0 %, Completeness (bb): 90.2 % Detail

Polymer type: polydeoxyribonucleotide

	Total	¹H
All	86.0 % (252 of 293)	86.0 % (252 of 293)
Suger, PO4	90.2 % (202 of 224)	90.2 % (202 of 224)
Nucleobase	72.5 % (50 of 69)	72.5 % (50 of 69)
Aromatic	73.4 % (47 of 64)	73.4 % (47 of 64)
Methyl	100.0 % (3 of 3)	100.0 % (3 of 3)

1. entity 1

AGGGCGGTGT GGGAAGAGGG AAGATGGGGA GG

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 310 K, pH 6.66, Details 2 mM KRAS32R G25T no labelled, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
1	KRAS32R G25T no labelled	natural abundance	2 mM
2	KCl	natural abundance	50 mM
3	KPi	natural abundance	10 mM

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 310 K, pH 6.66, Details 0.5 mM [U-99% 13C; U-99% 15N] KRAS32R G25T, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
4	KRAS32R G25T	[U-99% 13C; U-99% 15N]	0.5 mM
5	KCl	natural abundance	50 mM
6	KPi	natural abundance	10 mM

Release date

2019-10-24

Citation

Structure of two G-quadruplexes in equilibrium in the KRAS promoter
Marquevielle, J., Robert, C., Lagrabette, O., Wahid, M., Bourdoncle, A., Xodo, L., Mergny, J.L., Salgado, G.
Nucleic Acids Res. (2020), 48, 9336-9345, PubMed 32432667 , DOI 10.1093/nar/gkaa387 , Abstract

Experiments performed 3 experiments Detail

Chemical shift validation 4 contents Detail

Properties

Input source #1: Assigned chemical shifts - Assigned chemical shifts	bmr34441_3.str
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Content subtype: bmr34441_3.str

#	Content subtype	Saveframe	Status	# of rows	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	304		100.0 (chain: 1, length: 32)
1	Chemical shift references	chem_shift_reference_1	OK	3		No information

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: 1, Chain length: 32, Sequence coverage: 100.0%

--------10--------20--------30--
AGGGCGGTGTGGGAAGAGGGAAGATGGGGAGG
||||||||||||||||||||||||||||||||
AGGGCGGTGTGGGAAGAGGGAAGATGGGGAGG

Total number of assignments
- ¹H chemical shifts: 258
- ¹³C chemical shifts: 34
- ¹⁵N chemical shifts: 12

Completeness of assignments

Entity_assemble_ID: 1

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	DA	C2	152.403
1	DA	C8	139.163
2	DG	C8	138.848
2	DG	N1	144.486
3	DG	C8	134.35
3	DG	N1	144.978
4	DG	C8	135.344
4	DG	N1	144.493
5	DC	C6	141.56
6	DG	C8	135.386
6	DG	N1	144.402
7	DG	C8	135.793
7	DG	N1	142.516
8	DT	C6	137.535
9	DG	C8	135.415
9	DG	N1	144.187
10	DT	C6	137.654
11	DG	C8	138.84
11	DG	N1	144.67
12	DG	C8	136.038
12	DG	N1	143.257
13	DG	C8	135.343
13	DG	N1	142.411
14	DA	C2	152.613
14	DA	C8	137.035
15	DA	C8	139.087
16	DG	C8	136.636
17	DA	C8	139.059
18	DG	C8	136.474
19	DG	C8	136.704
20	DG	C8	136.609
21	DA	C8	139.29
22	DA	C8	136.457
23	DG	C8	136.65
24	DA	C8	139.26
25	DT	C6	136.809
26	DG	C8	135.564
26	DG	N1	144.649
27	DG	C8	134.773
27	DG	N1	143.285
28	DG	C8	134.649
28	DG	N1	144.184
29	DG	C8	135.346
30	DA	C8	138.836
31	DG	C8	139.505
32	DG	C8	136.528

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	293	252	86.0

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	224	202	90.2

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	69	50	72.5

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	3	3	100.0
¹³C chemical shifts	3	0	0.0

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	36	30	83.3

Histogram of normalized assigned chemical shifts

Keywords DNA, KRAS G-quadruplex

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.249 seconds)

BMRB: 34441

Sample #1

Sample #2

Experiments performed 3 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Chemical shift validation 4 contents Detail