BMRBj - BMREntryMaster

Found 1 Document (0.244 seconds)

BMRB: 34664

Parallel Q-D hybrid with 3' duplex stem-loop as a lateral snapback loop

Authors

Vianney, Y.M., Weisz, K.

Assembly

TTAMycdup-3sbl

Entity

1. TTAMycdup-3sbl (polymer, Thiol state: not present), 36 monomers, 11273.22 Da Detail

XTAGGTGGGT AGGGTGGGCT AGTCATTTTG ACTAGG

Formula weight

11273.22 Da

Source organism

synthetic construct

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 97.2 %, Completeness: 66.3 %, Completeness (bb): 57.1 % Detail

Polymer type: polydeoxyribonucleotide

	Total	¹H
All	66.3 % (220 of 332)	66.3 % (220 of 332)
Suger, PO4	57.1 % (140 of 245)	57.1 % (140 of 245)
Nucleobase	92.0 % (80 of 87)	92.0 % (80 of 87)
Aromatic	90.0 % (63 of 70)	90.0 % (63 of 70)
Methyl	100.0 % (11 of 11)	100.0 % (11 of 11)

1. entity 1

XTAGGTGGGT AGGGTGGGCT AGTCATTTTG ACTAGG

Show sample condition

Sample

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K, pH 7.0, Details 1 mM 0 DNA, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
1	DNA	natural abundance		1 mM
2	potassium phosphate buffer	natural abundance		10 mM

Release date

2021-09-08

Citation

Indoloquinoline Ligands Favor Intercalation at Quadruplex-Duplex Interfaces
Vianney, Y.M., Weisz, K.
Chemistry (2022), 28, e202103718-e202103718, PubMed 34905232 , DOI 10.1002/chem.202103718 , Abstract

Entries sharing articles BMRB: 1 entries Detail

BMRB: 34665 released on 2021-09-08
Title Solution structure of 1:1 complex of an indoloquinoline derivative SYUIQ-5 to parallel quadruplex-duplex (Q-D) hybrid

Experiments performed 3 experiments Detail

Chemical shift validation 3 contents Detail

Properties

Input source #1: Assigned chemical shifts - Assigned chemical shifts	bmr34664_3.str
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
1	1	THM	THYMIDINE	Assigned chemical shifts

Content subtype: bmr34664_3.str

#	Content subtype	Saveframe	Status	# of rows	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	292		100.0 (chain: 1, length: 36)
1	Chemical shift references	chem_shift_reference_1	OK	2		No information

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: 1, Chain length: 36, Sequence coverage: 100.0%

--------10--------20--------30------
XTAGGTGGGTAGGGTGGGCTAGTCATTTTGACTAGG
||||||||||||||||||||||||||||||||||||
XTAGGTGGGTAGGGTGGGCTAGTCATTTTGACTAGG

Total number of assignments
- ¹H chemical shifts: 250
- ¹³C chemical shifts: 42

Completeness of assignments

Entity_assemble_ID: 1

Excluded Comp_ID in statistics

Comp_index_ID	Comp_ID
1	THM

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
2	DT	C6	139.023
3	DA	C2	153.933
3	DA	C8	142.17
4	DG	C8	138.218
5	DG	C8	137.994
6	DT	C6	139.929
7	DG	C8	138.413
8	DG	C8	138.072
9	DG	C8	138.189
10	DT	C6	140.079
11	DA	C2	154.914
11	DA	C8	143.343
12	DG	C8	138.463
13	DG	C8	138.393
14	DG	C8	138.417
15	DT	C6	140.095
16	DG	C8	138.088
17	DG	C8	138.412
18	DG	C8	137.817
19	DC	C6	142.991
20	DT	C6	139.628
21	DA	C2	154.051
21	DA	C8	141.863
22	DG	C8	137.205
23	DT	C6	138.492
24	DC	C6	143.566
25	DA	C2	155.153
25	DA	C8	142.05
26	DT	C6	139.346
27	DT	C6	139.426
28	DT	C6	139.57
29	DT	C6	139.525
30	DG	C8	138.381
31	DA	C2	155.041
31	DA	C8	142.063
32	DC	C6	141.859
33	DT	C6	139.668
34	DA	C2	154.013
34	DA	C8	141.827
35	DG	C8	136.774
36	DG	C8	139.895

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	332	220	66.3

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	245	140	57.1

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	87	80	92.0

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	11	11	100.0
¹³C chemical shifts	11	0	0.0

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	27	27	100.0

Histogram of normalized assigned chemical shifts

Keywords DNA, G-quadruplex, Quadruplex-duplex junction, duplex

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.244 seconds)

BMRB: 34664

Sample

Entries sharing articles BMRB: 1 entries Detail

Experiments performed 3 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Chemical shift validation 3 contents Detail