BMRBj - BMREntryMaster

Found 1 Document (0.465 seconds)

BMRB: 18515

2LUB

high resolution NMR solution structure of helix H1 of the human HAR1 RNA

Authors

Cevec, M., Ziegeler, M., Richter, C., Schwalbe, H.

Assembly

RNA (37-MER)

Entity

1. RNA (37-MER) (polymer, Thiol state: not present), 37 monomers, 11950.07 Da Detail

GGGUGAAACG GAGGACUUCG GUCCUCAAGU UUCACCC

Formula weight

11950.07 Da

Source organism

Exptl. method

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 75.0 %, Completeness (bb): 64.4 % Detail

Polymer type: polyribonucleotide

	Total	¹H
All	75.0 % (243 of 324)	75.0 % (243 of 324)
Suger, PO4	64.4 % (143 of 222)	64.4 % (143 of 222)
Nucleobase	98.0 % (100 of 102)	98.0 % (100 of 102)
Aromatic	97.6 % (80 of 82)	97.6 % (80 of 82)

1. RNA (37-MER)

GGGUGAAACG GAGGACUUCG GUCCUCAAGU UUCACCC

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Type	Concentration
1	RNA (37-MER)	[U-100% 15N]		1 mM
2	potassium chloride	natural abundance		50 mM
3	potassium phosphate	natural abundance		25 mM
4	H2O	natural abundance		90 %
5	D2O	natural abundance		10 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Type	Concentration
6	RNA (37-MER)	[U-100% 15N]		1 mM
7	potassium chloride	natural abundance		50 mM
8	potassium phosphate	natural abundance		25 mM
9	D2O	natural abundance		100 %

Release date

2012-07-23

Citation

NMR studies of HAR1 RNA secondary structures reveal conformational dynamics in the human RNA
Ziegeler, M., Cevec, M., Richter, C., Schwalbe, H.
Chembiochem. (2012), 13, 2100-2112, PubMed 22961937 , DOI 10.1002/cbic.201200401 , Abstract

Entries sharing articles BMRB: 2 entries Detail

  BMRB: 17861 released on 2014-04-22
    Title high resolution NMR solution structure of helix H1 of the human HAR1F RNA
  BMRB: 17860 released on 2012-07-23
    Title high resolution NMR solution structure of helix H1 of the chimpanzee HAR1 RNA

Related entities 1. RNA (37-MER), : 1 : 1 entities Detail

Experiments performed 9 experiments Detail

1 2D 1H-15N HSQC

Instrument

Bruker Avance - 900 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.2

#	Name	Isotope labeling	Type	Concentration
1	RNA (37-MER)	[U-100% 15N]		1 mM
2	potassium chloride	natural abundance		50 mM
3	potassium phosphate	natural abundance		25 mM
4	H2O	natural abundance		90 %
5	D2O	natural abundance		10 %

2 2D HNN-COSY

Instrument

Bruker Avance - 900 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.2

#	Name	Isotope labeling	Type	Concentration
1	RNA (37-MER)	[U-100% 15N]		1 mM
2	potassium chloride	natural abundance		50 mM
3	potassium phosphate	natural abundance		25 mM
4	H2O	natural abundance		90 %
5	D2O	natural abundance		10 %

3 2D 1H-1H NOESY

Instrument

Bruker Avance - 900 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.2

#	Name	Isotope labeling	Type	Concentration
1	RNA (37-MER)	[U-100% 15N]		1 mM
2	potassium chloride	natural abundance		50 mM
3	potassium phosphate	natural abundance		25 mM
4	H2O	natural abundance		90 %
5	D2O	natural abundance		10 %

4 3D 1H-15N NOESY

Instrument

Bruker Avance - 900 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.2

#	Name	Isotope labeling	Type	Concentration
1	RNA (37-MER)	[U-100% 15N]		1 mM
2	potassium chloride	natural abundance		50 mM
3	potassium phosphate	natural abundance		25 mM
4	H2O	natural abundance		90 %
5	D2O	natural abundance		10 %

5 2D 1H-15N CPMG-NOESY

Instrument

Bruker Avance - 900 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.2

#	Name	Isotope labeling	Type	Concentration
1	RNA (37-MER)	[U-100% 15N]		1 mM
2	potassium chloride	natural abundance		50 mM
3	potassium phosphate	natural abundance		25 mM
4	H2O	natural abundance		90 %
5	D2O	natural abundance		10 %

6 2D 1H-13C HSQC

Instrument

Bruker Avance - 900 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Type	Concentration
6	RNA (37-MER)	[U-100% 15N]		1 mM
7	potassium chloride	natural abundance		50 mM
8	potassium phosphate	natural abundance		25 mM
9	D2O	natural abundance		100 %

7 2D 1H-1H NOESY

Instrument

Bruker Avance - 900 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Type	Concentration
6	RNA (37-MER)	[U-100% 15N]		1 mM
7	potassium chloride	natural abundance		50 mM
8	potassium phosphate	natural abundance		25 mM
9	D2O	natural abundance		100 %

8 2D DQF-COSY

Instrument

Bruker Avance - 900 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Type	Concentration
6	RNA (37-MER)	[U-100% 15N]		1 mM
7	potassium chloride	natural abundance		50 mM
8	potassium phosphate	natural abundance		25 mM
9	D2O	natural abundance		100 %

9 2D 1H-1H TOCSY

Instrument

Bruker Avance - 900 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Type	Concentration
6	RNA (37-MER)	[U-100% 15N]		1 mM
7	potassium chloride	natural abundance		50 mM
8	potassium phosphate	natural abundance		25 mM
9	D2O	natural abundance		100 %

NMR combined restraints 7 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_18515_2lub.nef
Input source #2: Coordindates	2lub.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30-------
GGGUGAAACGGAGGACUUCGGUCCUCAAGUUUCACCC
|||||||||||||||||||||||||||||||||||||
GGGUGAAACGGAGGACUUCGGUCCUCAAGUUUCACCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	37	0	0	100.0

Content subtype: combined_18515_2lub.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	277		100.0 (chain: A, length: 37)
1	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	423 (1)	noe	100.0 (chain: A, length: 37)
2	Distance restraints	CNS/XPLOR_distance_constraints_7	Warning	361 (1)	noe	100.0 (chain: A, length: 37)
3	Distance restraints	CNS/XPLOR_distance_constraints_5	Warning	82 (1)	hbond	86.5 (chain: A, length: 37)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_4	OK	269 (269)	.	97.3 (chain: A, length: 37)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_2	OK	69 (69)	.	70.3 (chain: A, length: 37)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 37, Sequence coverage: 100.0%

--------10--------20--------30-------
GGGUGAAACGGAGGACUUCGGUCCUCAAGUUUCACCC
|||||||||||||||||||||||||||||||||||||
GGGUGAAACGGAGGACUUCGGUCCUCAAGUUUCACCC

Total number of assignments
- ¹H chemical shifts: 277

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
2	G	H22	6.058
3	G	H21	8.475
3	G	H22	6.072
3	G	HO2'	7.016
6	A	H61	7.778
6	A	H62	6.638
7	A	H61	7.924
7	A	H62	6.712
7	A	HO2'	6.806
8	A	H61	8.114
8	A	H62	6.611
8	A	HO2'	6.899
11	G	H21	7.692
11	G	H22	5.816
12	A	H62	6.388
13	G	H21	8.341
13	G	H22	6.082
14	G	H21	7.994
14	G	H22	5.891
15	A	H61	8.442
15	A	H62	6.676
16	C	HO2'	7.037
17	U	HO2'	6.773
21	G	H21	8.849
21	G	H22	6.719
21	G	HO2'	6.899
24	C	HO2'	6.75
29	G	H21	8.61
29	G	H22	6.418
33	C	HO2'	6.625
34	A	H61	8.002
34	A	H62	6.385
35	C	HO2'	6.86
36	C	HO2'	6.871

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	324	243	75.0

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	222	143	64.4

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	102	100	98.0

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	27	27	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_3
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 37, Sequence coverage: 100.0%
- Total number of restraints: 423
- Weight of restraints: 1.0 (423)
- Potential type of restraints: square-well-parabolic (423)
- Range of distance target values: 1.85, 4.5 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_7
  - Status: Warning
  - Experiment type: noe
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 37, Sequence coverage: 100.0%
  - Total number of restraints: 361
  - Weight of restraints: 1.0 (361)
  - Potential type of restraints: square-well-parabolic (361)
  - Range of distance target values: 2.3, 4.4 (Å)
  - Histogram of distance target values
  - Histogram of discrepancy in distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map
  - Saveframe: CNS/XPLOR_distance_constraints_5
    - Status: Warning
    - Experiment type: hbond
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 37, Sequence coverage: 86.5%
    - Total number of restraints: 82
    - Weight of restraints: 1.0 (82)
    - Potential type of restraints: square-well-parabolic (82)
    - Range of distance target values: 1.61, 3.0 (Å)
    - Histogram of distance target values
    - Distance restraints per residue
      - Chain_ID: A
    - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_4
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 37, Sequence coverage: 97.3%
- Total number of restraints: 269
- Total number of restraints per polymer type: 269
- Weight of restraints: 1.0 (269)
- Potential type of restraints: square-well-parabolic (269)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_2
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 37, Sequence coverage: 70.3%
- Total number of restraints: 69
- Potential type of restraints: undefined (69)
- Range of observed RDC values: 100.0, -100.0 (Hz)
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords hairpin, human HAR1 RNA, UUCG tetraloop