Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid
Polymer type: polydeoxyribonucleotide
Total | 1H | |
---|---|---|
All | 80.7 % (246 of 305) | 80.7 % (246 of 305) |
Suger, PO4 | 78.6 % (176 of 224) | 78.6 % (176 of 224) |
Nucleobase | 86.4 % (70 of 81) | 86.4 % (70 of 81) |
Aromatic | 89.1 % (57 of 64) | 89.1 % (57 of 64) |
Methyl | 100.0 % (7 of 7) | 100.0 % (7 of 7) |
1. DNA (32-MER)
TTGGGTGGGC GCGAAGCATT CGCGGGGTGG GTSolvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | DNA (32-MER) | natural abundance | 0.5-2.0 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | natural abundance | 10 % |
Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | DNA (32-MER) | natural abundance | 0.5-2.0 mM |
Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
5 | DNA (32-MER) | [U-2% 15N] | 0.5-2.0 mM |
Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
6 | DNA (32-MER) | [U-100% 2H] | 0.5-2.0 mM |