Properties

Disulfide bonds

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Non-standard residues

Content subtype: bmr34665_3.str

Assigned chemical shifts

1. Saveframe: assigned_chemical_shifts_1
   • Status: Warning
   • Sequence coverage of experimental data
     • Entity_assembly_ID: 1, Chain length: 36, Sequence coverage: 100.0%

     --------10--------20--------30------
     XTAGGTGGGTAGGGTGGGCTAGTCATTTTGACTAGG
     ||||||||||||||||||||||||||||||||||||
     XTAGGTGGGTAGGGTGGGCTAGTCATTTTGACTAGG
     

   • Total number of assignments
     • ¹H chemical shifts: 236
     • ¹³C chemical shifts: 37
   • Completeness of assignments
     • Entity_assemble_ID: 1
       • Excluded Comp_ID in statistics

         Comp_index_ID	Comp_ID
         1	THM

       • Excluded Atom_ID in statistics

         Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
         2	DT	C6	138.874
         3	DA	C2	154.505
         3	DA	C8	141.71
         4	DG	C8	137.728
         5	DG	C8	137.201
         6	DT	C6	139.721
         7	DG	C8	138.212
         8	DG	C8	137.827
         9	DG	C8	138.168
         10	DT	C6	139.91
         11	DA	C2	155.365
         11	DA	C8	143.058
         12	DG	C8	138.255
         13	DG	C8	137.726
         14	DG	C8	138.124
         15	DT	C6	139.98
         16	DG	C8	137.632
         17	DG	C8	137.821
         19	DC	C6	143.312
         20	DT	C6	139.259
         21	DA	C8	141.661
         22	DG	C8	136.931
         23	DT	C6	138.243
         24	DC	C6	143.309
         25	DA	C2	155.001
         25	DA	C8	141.859
         26	DT	C6	139.18
         27	DT	C6	139.219
         28	DT	C6	139.367
         29	DT	C6	139.278
         30	DG	C8	138.125
         31	DA	C2	154.887
         31	DA	C8	141.866
         32	DC	C6	141.648
         33	DT	C6	139.338
         34	DA	C8	141.186

       • All atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	332	206	62.0

       • Backbone atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	245	135	55.1

       • Side chain atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	87	71	81.6

       • Methyl group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	11	11	100.0
         13C chemical shifts	11	0	0.0

       • Aromatic group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	27	25	92.6

   • Histogram of normalized assigned chemical shifts