BMRBj - BMREntryMaster

Found 1 Document (0.413 seconds)

BMRB: 15859

2K66

NMR solution structure of the d3'-stem closed by a GAAA tetraloop of the group II intron Sc.ai5(gamma)

Authors

Kruschel, D., Sigel, R.K. O.

Assembly

29-MER

Entity

1. 29-MER (polymer, Thiol state: not present), 22 monomers, 7145.245 Da Detail

GGAGUAUGUG AAAGCAUACU CC

Formula weight

7145.245 Da

Source organism

Saccharomyces cerevisiae

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 66.7 %, Completeness (bb): 52.9 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	66.7 % (232 of 348)	86.8 % (164 of 189)	39.2 % (58 of 148)	90.9 % (10 of 11)
Suger, PO4	52.9 % (128 of 242)	81.1 % (107 of 132)	19.1 % (21 of 110)
Nucleobase	98.1 % (104 of 106)	100.0 % (57 of 57)	97.4 % (37 of 38)	90.9 % (10 of 11)
Aromatic	98.0 % (96 of 98)	100.0 % (49 of 49)	97.4 % (37 of 38)	90.9 % (10 of 11)

1. RNA (22-MER)

GGAGUAUGUG AAAGCAUACU CC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
1	RNA (22-MER)	natural abundance	0.9-1.3 mM
2	potassium chloride	natural abundance	10 mM
3	EDTA	natural abundance	10 uM
4	D2O	[U-100% 2H]	100 %

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
5	RNA (22-MER)	natural abundance	0.9-1.3 mM
6	potassium chloride	natural abundance	10 mM
7	EDTA	natural abundance	10 uM
8	H2O	natural abundance	90 %
9	D2O	[U-100% 2H]	10 %

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
10	RNA (22-MER)	[U-100% 13C; U-100% 15N]	1.0 mM
11	potassium chloride	natural abundance	10 mM
12	EDTA	natural abundance	10 uM
13	D2O	[U-100% 2H]	100 %

Sample #4

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
14	RNA (22-MER)	[U-100% 13C; U-100% 15N]	1.0 mM
15	potassium chloride	natural abundance	10 mM
16	EDTA	natural abundance	10 uM
17	H2O	natural abundance	90 %
18	D2O	[U-100% 2H]	10 %

Release date

2009-10-12

Citation

NMR structure of the 5' splice site in the group IIB intron Sc.ai5γ--conformational requirements for exon-intron recognition
Kruschel, D., Sigel, R.K. O.
RNA (2014), 20, 295-307, PubMed 24448450 , DOI 10.1261/rna.041137.113 , Abstract

Entries sharing articles BMRB: 5 entries Detail

  BMRB: 18893 released on 2013-12-15
    Title NMR solution structure of the d3'-hairpin of the group II intron Sc.ai5gamma including EBS1 bound to IBS1
  BMRB: 18894 released on 2013-12-15
    Title NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma
  BMRB: 15856 released on 2009-10-12
    Title NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5(gamma)
  BMRB: 15857 released on 2009-10-12
    Title NMR solution structure of the d3'-hairpin including EBS1 together with IBS1 of the group II intron Sc.ai5(gamma)
  BMRB: 15858 released on 2009-10-11
    Title NMR solution structure of the exon/intron binding site 1 (EBS1/IBS1) of the group II intron Sc.ai5(gamma)

Related entities 1. 29-MER, : 1 entities Detail

Experiments performed 6 experiments Detail

NMR combined restraints 8 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_15859_2k66.nef
Input source #2: Coordindates	2k66.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--
GGAGUAUGUGAAAGCAUACUCC
||||||||||||||||||||||
GGAGUAUGUGAAAGCAUACUCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	22	0	0	100.0

Content subtype: combined_15859_2k66.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	252		100.0 (chain: A, length: 22)
1	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	369 (1)	noe	100.0 (chain: A, length: 22)
2	Distance restraints	CNS/XPLOR_distance_constraints_5	OK	102 (1)	noe	95.5 (chain: A, length: 22)
3	Distance restraints	CNS/XPLOR_distance_constraints_7	Warning	49 (1)	noe	90.9 (chain: A, length: 22)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_9	OK	89 (89)	.	100.0 (chain: A, length: 22)
2	Dihedral angle restraints	CNS/XPLOR_dihedral_11	OK	51 (51)	.	77.3 (chain: A, length: 22)
3	Dihedral angle restraints	CNS/XPLOR_dihedral_13	OK	22 (22)	.	100.0 (chain: A, length: 22)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning
Sequence coverage of experimental data
- Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
Total number of assignments
- ¹H chemical shifts: 183
- ¹³C chemical shifts: 58
- ¹⁵N chemical shifts: 11

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	H21	7.891
1	G	H22	5.604
2	G	H21	7.822
2	G	H22	5.665
3	A	H61	8.049
3	A	H62	6.71
4	G	H21	8.082
4	G	H22	5.943
6	A	H61	7.573
6	A	H62	6.181
8	G	H21	7.628
8	G	H22	5.726
10	G	H22	5.931
14	G	H21	8.07
14	G	H22	5.937
16	A	H61	7.559
16	A	H62	6.18
18	A	H61	7.658
18	A	H62	6.165
20	U	N1	162.1

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	189	164	86.8
¹³C chemical shifts	148	58	39.2
¹⁵N chemical shifts	11	10	90.9

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	132	107	81.1
¹³C chemical shifts	110	21	19.1

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	57	57	100.0
¹³C chemical shifts	38	37	97.4
¹⁵N chemical shifts	11	10	90.9

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	20	20	100.0
¹³C chemical shifts	20	19	95.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_3
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
- Total number of restraints: 369
- Weight of restraints: 1.0 (369)
- Potential type of restraints: square-well-parabolic (369)
- Range of distance target values: 2.4, 5.5 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_5
  - Status: OK
  - Experiment type: noe
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 95.5%
  - Total number of restraints: 102
  - Weight of restraints: 1.0 (102)
  - Potential type of restraints: square-well-parabolic (102)
  - Range of distance target values: 2.4, 5.5 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map
  - Saveframe: CNS/XPLOR_distance_constraints_7
    - Status: Warning
    - Experiment type: noe
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 90.9%
    - Total number of restraints: 49
    - Weight of restraints: 1.0 (49)
    - Potential type of restraints: square-well-parabolic (49)
    - Range of distance target values: 1.95, 2.95 (Å)
    - Histogram of distance target values
    - Distance restraints per residue
      - Chain_ID: A
    - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_9
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
- Total number of restraints: 89
- Total number of restraints per polymer type: 89
- Weight of restraints: 1.0 (89)
- Potential type of restraints: square-well-parabolic (89)
- Dihedral angle restraints per residue
  - Chain_ID: A
- Saveframe: CNS/XPLOR_dihedral_11
  - Status: OK
  - Experiment type: .
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 77.3%
  - Total number of restraints: 51
  - Total number of restraints per polymer type: 51
  - Weight of restraints: 1.0 (51)
  - Potential type of restraints: square-well-parabolic (51)
  - Dihedral angle restraints per residue
    - Chain_ID: A
  - Saveframe: CNS/XPLOR_dihedral_13
    - Status: OK
    - Experiment type: .
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
    - Total number of restraints: 22
    - Total number of restraints per polymer type: 22
    - Weight of restraints: 1.0 (22)
    - Potential type of restraints: square-well-parabolic (22)
    - Dihedral angle restraints per residue
      - Chain_ID: A

Keywords d3'-stem, GAAA tetraloop, group II intron, hairpin, NMR, ribozyme, RNA 22-mer, splicing

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.413 seconds)

BMRB: 15859

Sample #1

Sample #2

Sample #3

Sample #4

Entries sharing articles BMRB: 5 entries Detail

Related entities 1. 29-MER, : 1 entities Detail

Experiments performed 6 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 8 contents Detail