Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid
Polymer type: polydeoxyribonucleotide
Total | 1H | |
---|---|---|
All | 85.0 % (256 of 301) | 85.0 % (256 of 301) |
Suger, PO4 | 82.1 % (184 of 224) | 82.1 % (184 of 224) |
Nucleobase | 93.5 % (72 of 77) | 93.5 % (72 of 77) |
Aromatic | 95.3 % (61 of 64) | 95.3 % (61 of 64) |
Methyl | 100.0 % (3 of 3) | 100.0 % (3 of 3) |
1. DNA (32-MER)
GCGCGAAGCA TTCGCGGGGA GGTGGGGAAG GGSolvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | DNA (32-MER) | natural abundance | 0.5-2.0 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | natural abundance | 10 % |
Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | DNA (32-MER) | natural abundance | 0.5-2.0 mM | |
5 | D2O | natural abundance | 100 % |
Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
6 | DNA (32-MER) | [U-2% 15N] | 0.5-2.0 mM | |
7 | H2O | natural abundance | 90 % | |
8 | D2O | natural abundance | 10 % |
Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | DNA (32-MER) | [U-100% 2H] | 0.5-2.0 mM | |
10 | D2O | natural abundance | 100 % |