Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid
Polymer type: polydeoxyribonucleotide
Total | 1H | |
---|---|---|
All | 85.2 % (241 of 283) | 85.2 % (241 of 283) |
Suger, PO4 | 81.9 % (172 of 210) | 81.9 % (172 of 210) |
Nucleobase | 94.5 % (69 of 73) | 94.5 % (69 of 73) |
Aromatic | 96.7 % (58 of 60) | 96.7 % (58 of 60) |
Methyl | 100.0 % (3 of 3) | 100.0 % (3 of 3) |
1. DNA (30-MER)
GGGAAGGGCG CGAAGCATTC GCGAGGTAGGSolvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | DNA (30-MER) | natural abundance | 0.5-2.0 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | natural abundance | 10 % |
Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | DNA (30-MER) | natural abundance | 0.5-2.0 mM |
Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
5 | DNA (30-MER) | [U-2% 15N] | 0.5-2.0 mM |
Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
6 | DNA (30-MER) | [U-100% 2H] | 0.5-2.0 mM |