BMRBj - BMREntryMaster

Found 1 Document (0.393 seconds)

BMRB: 25780

2N6S

Structure of CssA4 (bottom stem) of CssA thermometer

Authors

Barnwal, R.P., Godin, K.S., Varani, G., Loh, E., Yip, J., Tang, C.M.

Assembly

CssA4 (bottom stem) of CssA thermometer

Entity

1. CssA4 (bottom stem) of CssA thermometer (polymer, Thiol state: not present), 36 monomers, 11537.76 Da Detail

GGAAUUUAUG AGUACCUUCG GAUACUUAUA GAUUCC

Formula weight

11537.76 Da

Source organism

Neisseria meningitidis

Exptl. method

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 51.2 %, Completeness (bb): 33.6 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	51.2 % (296 of 578)	64.9 % (203 of 313)	31.0 % (76 of 245)	85.0 % (17 of 20)
Suger, PO4	33.6 % (133 of 396)	50.9 % (110 of 216)	12.8 % (23 of 180)
Nucleobase	89.6 % (163 of 182)	95.9 % (93 of 97)	81.5 % (53 of 65)	85.0 % (17 of 20)
Aromatic	88.8 % (151 of 170)	95.3 % (81 of 85)	81.5 % (53 of 65)	85.0 % (17 of 20)

1. RNA (36-MER)

GGAAUUUAUG AGUACCUUCG GAUACUUAUA GAUUCC

Show sample condition

Sample

Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA4 (36mer)	natural abundance		0.4 ~ 1.1 mM
2	CssA4 (36mer)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA4 (36mer)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA4 (36mer)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

Release date

2016-07-25

Citation

Structure and mechanism of a molecular rheostat, an RNA thermometer that modulates immune evasion by Neisseria meningitidis
Barnwal, R.P., Loh, E., Godin, K.S., Yip, J., Lavender, H., Tang, C.M., Varani, G.
Nucleic Acids Res. (2016), 44, 9426-9437, PubMed 27369378 , DOI 10.1093/nar/gkw584 , Abstract

Entries sharing articles BMRB: 3 entries Detail

  BMRB: 25781 released on 2016-07-25
    Title NMR Assignment and NMR Structure of CssA3 (top stem) of CssA thermometer
  BMRB: 25784 released on 2016-07-25
    Title NMR Assignment and structure of CssA Thermometer from Neisseria meningitidis
  BMRB: 25785 released on 2016-07-25
    Title NMR Assignment and structure of CssA5 (middle region) of CssA thermometer from Neisseria meningitidis

Experiments performed 9 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA4 (36mer)	natural abundance		0.4 ~ 1.1 mM
2	CssA4 (36mer)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA4 (36mer)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA4 (36mer)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

2 2D 1H-1H TOCSY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA4 (36mer)	natural abundance		0.4 ~ 1.1 mM
2	CssA4 (36mer)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA4 (36mer)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA4 (36mer)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

3 2D DQF-COSY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA4 (36mer)	natural abundance		0.4 ~ 1.1 mM
2	CssA4 (36mer)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA4 (36mer)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA4 (36mer)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

4 2D 1H-13C HSQC

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA4 (36mer)	natural abundance		0.4 ~ 1.1 mM
2	CssA4 (36mer)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA4 (36mer)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA4 (36mer)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

5 2D 1H-15N HSQC

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA4 (36mer)	natural abundance		0.4 ~ 1.1 mM
2	CssA4 (36mer)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA4 (36mer)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA4 (36mer)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

6 3D 1H-13C NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA4 (36mer)	natural abundance		0.4 ~ 1.1 mM
2	CssA4 (36mer)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA4 (36mer)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA4 (36mer)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

7 3D HCCH-TOCSY

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA4 (36mer)	natural abundance		0.4 ~ 1.1 mM
2	CssA4 (36mer)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA4 (36mer)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA4 (36mer)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

8 ARTSY

Instrument

Agilent INOVA - 900 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA4 (36mer)	natural abundance		0.4 ~ 1.1 mM
2	CssA4 (36mer)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA4 (36mer)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA4 (36mer)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

9 ARTSY

Instrument

Agilent INOVA - 900 MHz

Sample

State anisotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 280 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA4 (36mer)	natural abundance		0.4 ~ 1.1 mM
2	CssA4 (36mer)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA4 (36mer)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA4 (36mer)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

NMR combined restraints 4 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints	combined_25780_2n6s.nef
Input source #2: Coordindates	2n6s.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	True (see coodinates for details)
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Ptnr_site_1	Ptnr_site_2	Redox_state_prediction_1	Redox_state_prediction_2	Distance (Å)
1:1:G:O3'	1:2:G:P	unknown	unknown	n/a

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30------
GGAAUUUAUGAGUACCUUCGGAUACUUAUAGAUUCC
||||||||||||||||||||||||||||||||||||
GGAAUUUAUGAGUACCUUCGGAUACUUAUAGAUUCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	36	0	0	100.0

Content subtype: combined_25780_2n6s.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Covalent bonds	assembly	OK	1		No information
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	308		100.0 (chain: A, length: 36)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	OK	544 (1)	noe	100.0 (chain: A, length: 36)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	74 (1)	hbond	94.4 (chain: A, length: 36)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 36, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 215
  - ¹³C chemical shifts: 76
  - ¹⁵N chemical shifts: 17
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Covalent bonds

Saveframe: assembly
- Status: OK

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 36, Sequence coverage: 100.0%
- Total number of restraints: 544
- Weight of restraints: 1.0 (544)
- Potential type of restraints: square-well-parabolic (544)
- Range of distance target values: 2.2, 5.0 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 36, Sequence coverage: 94.4%
  - Total number of restraints: 74
  - Weight of restraints: 1.0 (74)
  - Potential type of restraints: square-well-parabolic (74)
  - Range of distance target values: 1.9, 2.8 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Keywords NMR, Neisseria meningitidis, RNA regulation, RNA thermometer, pathogen