BMRBj - BMREntryMaster

Found 1 Document (0.525 seconds)

BMRB: 25784

2N6W

NMR Assignment and structure of CssA Thermometer from Neisseria meningitidis

Authors

Barnwal, R.P., Godin, K.S., Varani, G.

Assembly

CssA Thermometer from Neisseria meningitidis

Entity

1. CssA Thermometer from Neisseria meningitidis (polymer, Thiol state: not present), 68 monomers, 21717.68 Da Detail

GGAAUUUAUG AGUACGUAGA GUAUAAUUAG UCUUCGGACU UCCUUAUACU UAUAUACUUA UAGAUUCC

Formula weight

21717.68 Da

Source organism

Neisseria meningitidis

Exptl. method

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 30.9 %, Completeness (bb): 18.2 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	30.9 % (338 of 1094)	47.5 % (281 of 591)	6.7 % (31 of 465)	68.4 % (26 of 38)
Suger, PO4	18.2 % (136 of 748)	33.3 % (136 of 408)	0.0 % (0 of 340)
Nucleobase	58.4 % (202 of 346)	79.2 % (145 of 183)	24.8 % (31 of 125)	68.4 % (26 of 38)
Aromatic	60.7 % (198 of 326)	86.5 % (141 of 163)	24.8 % (31 of 125)	68.4 % (26 of 38)

1. CssA RNA thermometer (68-MER)

GGAAUUUAUG AGUACGUAGA GUAUAAUUAG UCUUCGGACU UCCUUAUACU UAUAUACUUA UAGAUUCC

Show sample condition

Sample

Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA RNA thermometer (68-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA RNA thermometer (68-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA RNA thermometer (68-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA RNA thermometer (68-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

Release date

2016-07-25

Citation

Structure and mechanism of a molecular rheostat, an RNA thermometer that modulates immune evasion by Neisseria meningitidis
Barnwal, R.P., Loh, E., Godin, K.S., Yip, J., Lavender, H., Tang, C.M., Varani, G.
Nucleic Acids Res. (2016), 44, 9426-9437, PubMed 27369378 , DOI 10.1093/nar/gkw584 , Abstract

Entries sharing articles BMRB: 3 entries Detail

  BMRB: 25780 released on 2016-07-25
    Title Structure of CssA4 (bottom stem) of CssA thermometer
  BMRB: 25781 released on 2016-07-25
    Title NMR Assignment and NMR Structure of CssA3 (top stem) of CssA thermometer
  BMRB: 25785 released on 2016-07-25
    Title NMR Assignment and structure of CssA5 (middle region) of CssA thermometer from Neisseria meningitidis

Experiments performed 9 experiments Detail

1 2D 1H-15N HSQC

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA RNA thermometer (68-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA RNA thermometer (68-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA RNA thermometer (68-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA RNA thermometer (68-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

2 2D 1H-13C HSQC

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA RNA thermometer (68-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA RNA thermometer (68-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA RNA thermometer (68-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA RNA thermometer (68-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

3 2D 1H-1H TOCSY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA RNA thermometer (68-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA RNA thermometer (68-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA RNA thermometer (68-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA RNA thermometer (68-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

4 2D 1H-1H NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA RNA thermometer (68-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA RNA thermometer (68-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA RNA thermometer (68-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA RNA thermometer (68-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

5 2D DQF-COSY

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA RNA thermometer (68-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA RNA thermometer (68-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA RNA thermometer (68-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA RNA thermometer (68-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

6 3D HCCH-TOCSY

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA RNA thermometer (68-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA RNA thermometer (68-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA RNA thermometer (68-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA RNA thermometer (68-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

7 3D 1H-13C NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA RNA thermometer (68-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA RNA thermometer (68-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA RNA thermometer (68-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA RNA thermometer (68-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

8 ARTSY

Instrument

Agilent INOVA - 900 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA RNA thermometer (68-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA RNA thermometer (68-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA RNA thermometer (68-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA RNA thermometer (68-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

9 ARTSY

Instrument

Agilent INOVA - 900 MHz

Sample

State anisotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 273 K, pH 6.0

#	Name	Isotope labeling	Type	Concentration
1	CssA RNA thermometer (68-MER)	natural abundance		0.4 ~ 1.1 mM
2	CssA RNA thermometer (68-MER)	13C/15N-uniformly labeled		0.4 ~ 1.1 mM
3	CssA RNA thermometer (68-MER)	13C/15N-AU labeled		0.4 ~ 1.1 mM
4	CssA RNA thermometer (68-MER)	partially deuterated		0.4 ~ 1.1 mM
5	H2O	natural abundance		95 %
6	D2O	natural abundance		5 %

NMR combined restraints 4 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints	combined_25784_2n6w.nef
Input source #2: Coordindates	2n6w.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	True (see coodinates for details)
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Ptnr_site_1	Ptnr_site_2	Redox_state_prediction_1	Redox_state_prediction_2	Distance (Å)
1:1:G:O3'	1:2:G:P	unknown	unknown	n/a

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30--------40--------50--------60--------
GGAAUUUAUGAGUACGUAGAGUAUAAUUAGUCUUCGGACUUCCUUAUACUUAUAUACUUAUAGAUUCC
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GGAAUUUAUGAGUACGUAGAGUAUAAUUAGUCUUCGGACUUCCUUAUACUUAUAUACUUAUAGAUUCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	68	0	0	100.0

Content subtype: combined_25784_2n6w.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Covalent bonds	assembly	OK	1		No information
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	344		100.0 (chain: A, length: 68)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	920 (1)	noe	100.0 (chain: A, length: 68)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	110 (1)	hbond	73.5 (chain: A, length: 68)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 68, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 287
  - ¹⁵N chemical shifts: 26
  - ¹³C chemical shifts: 31
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Covalent bonds

Saveframe: assembly
- Status: OK

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 68, Sequence coverage: 100.0%
- Total number of restraints: 920
- Weight of restraints: 1.0 (920)
- Potential type of restraints: square-well-parabolic (920)
- Range of distance target values: 2.2, 5.25 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 68, Sequence coverage: 73.5%
  - Total number of restraints: 110
  - Weight of restraints: 1.0 (110)
  - Potential type of restraints: square-well-parabolic (110)
  - Range of distance target values: 1.9, 2.8 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Keywords NMR, Neisseria meningitidis, RNA regulation, RNA thermometer, pathogen